Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,441

5 members and 3,436 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,096
Threads: 248,538
Posts: 2,568,731
Top Poster: JLC (31,651)
Welcome to our newest member, eamorris97
Page 3 of 4 FirstFirst 1234 LastLast
Results 21 to 30 of 33
  1. #21
    Registered User
    Join Date
    03-14-2019
    Posts
    77
    Thanks
    48
    Thanked 35 Times in 22 Posts

    Re: Parthenogenesis occurred

    I would never underfeed on purpose (unless they were overweight), it was just a theoretical question.

    Besides, she goes off food anyway for several months each year so it's better if she has some fat storage for that.

    Although if for some reason she doesn't keep eating over the next few months, then that might stop her reproducing next year, or like with the boa you obtained it could cause complications if she did make eggs.

    Rest assured, I will try to get her back to around 3000g, and if she wants eggs again then so be it.

    She has been staying in the hide box a bit more the last few days, so her behaviour is getting a bit more normal.
    But I guess with the glass front covered up the whole vivarium itself is like a hidebox so it's not unexpected for her to be outside of the hidebox more if that makes sense.

    Thanks

  2. The Following User Says Thank You to colin-java For This Useful Post:

    Bogertophis (06-14-2020)

  3. #22
    Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,250
    Thanks
    28,168
    Thanked 19,830 Times in 11,847 Posts
    All the best with your gal...I don't expect her to go off-food for quite a while this year- if at all, but only time will tell. We'll be curious, right along with you, to see what's next.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  4. The Following User Says Thank You to Bogertophis For This Useful Post:

    colin-java (06-14-2020)

  5. #23
    Registered User
    Join Date
    04-15-2020
    Posts
    11
    Thanks
    2
    Thanked 24 Times in 8 Posts
    Images: 2
    Hey I had the same thing happen to me about 61 days ago. Partho in a 10 yr old female that I never bred. I just saw them pip last night. There were 4 slugs and 4 viable ones, and 3/4 hatched, and I expect the last to hatch as well as the egg is not discolored. I did maternal incubation with some vermiculate and later spagnum moss in a standard Ball Python hide with a UTH set to 90 on the thermostat. Humidity stayed around 87-90%, moist but not wet. Haven't read the whole thread but if you're going along with it then nest of luck!

  6. The Following 2 Users Say Thank You to Raptor Llama For This Useful Post:

    Bogertophis (06-14-2020),colin-java (06-14-2020)

  7. #24
    Registered User
    Join Date
    03-14-2019
    Posts
    77
    Thanks
    48
    Thanked 35 Times in 22 Posts

    Re: Parthenogenesis occurred

    Wow, that's cool, best of luck with your babies and I hope their mother gets back to normal soon too.

    I decided not to go through with incubation for a few reasons, one being I don't know how to artificially incubate them correctly, and I didn't wanna do it maternally cause she had lost a 1000g in weight and taking off another 2 months doesn't give her much time to put weight back (assuming I could get her eating again) before October/November when she goes off feed again.

    Its funny though, after I took her off the eggs to candle them, and put her back on, she did coil them, but then left them and started crawling around the guard for the heater, as though being pulled off the eggs made her not bothered about them so much.

    Post pics of your babies when you get chance, best of luck.

  8. #25
    Registered User
    Join Date
    04-15-2020
    Posts
    11
    Thanks
    2
    Thanked 24 Times in 8 Posts
    Images: 2

    Re: Parthenogenesis occurred

    Quote Originally Posted by colin-java View Post
    Wow, that's cool, best of luck with your babies and I hope their mother gets back to normal soon too.

    I decided not to go through with incubation for a few reasons, one being I don't know how to artificially incubate them correctly, and I didn't wanna do it maternally cause she had lost a 1000g in weight and taking off another 2 months doesn't give her much time to put weight back (assuming I could get her eating again) before October/November when she goes off feed again.

    Its funny though, after I took her off the eggs to candle them, and put her back on, she did coil them, but then left them and started crawling around the guard for the heater, as though being pulled off the eggs made her not bothered about them so much.

    Post pics of your babies when you get chance, best of luck.
    It is quite late in the season to be laying eggs; that makes sense.

    I posted some pics in my thread, link here: https://ball-pythons.net/forums/show...14#post2738214

  9. The Following User Says Thank You to Raptor Llama For This Useful Post:

    colin-java (06-14-2020)

  10. #26
    Registered User
    Join Date
    03-14-2019
    Posts
    77
    Thanks
    48
    Thanked 35 Times in 22 Posts

    Re: Parthenogenesis occurred

    Cute looking babies, did you get all 4?

    Did you take them out as soon as they left the egg, you don't want their mom to crush them.

    Is the patterning the same, or very close? Cause they would be clones

  11. #27
    Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,250
    Thanks
    28,168
    Thanked 19,830 Times in 11,847 Posts

    Re: Parthenogenesis occurred

    Quote Originally Posted by colin-java View Post
    ...Is the patterning the same, or very close? Cause they would be clones
    FYI, they may NOT look alike...the 3 "Florida" rat snakes that I hatched out last summer (via apparent parthenogenesis) sure don't. BUT, that might be due to the fact that their mom is a mix of Yellow, Gulf Hammock & maybe Everglades rat snakes that were captive-bred, then sold to me many years ago as young snakes (that I've never allowed to breed, & I actually have 2.2, but they've never been near each other & they live in different rooms.) Anyway, you'd think such offspring would ordinarily be identical when the mom is NOT a mix, but from what I've read, you can't quite count on that either. It's complicated... but ever so cool!
    Last edited by Bogertophis; 06-15-2020 at 07:20 PM.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  12. #28
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Parthenogenesis occurred

    Quote Originally Posted by colin-java View Post
    Is the patterning the same, or very close? Cause they would be clones
    They are not clones, they are HALF-clones

    And patterning is a stochastic process at the genetic/cellular level so the patterning will be different on all of them. The same way identical twins have different fingerprints
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  13. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (06-16-2020),GoingPostal (06-16-2020)

  14. #29
    Registered User
    Join Date
    03-14-2019
    Posts
    77
    Thanks
    48
    Thanked 35 Times in 22 Posts

    Re: Parthenogenesis occurred

    Quote Originally Posted by asplundii View Post
    They are not clones, they are HALF-clones

    And patterning is a stochastic process at the genetic/cellular level so the patterning will be different on all of them. The same way identical twins have different fingerprints
    I guess I need to read this...

    https://genetics.thetech.org/ask-a-g...esis-not-clone

  15. The Following User Says Thank You to colin-java For This Useful Post:

    Bogertophis (06-16-2020)

  16. #30
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Parthenogenesis occurred

    Quote Originally Posted by colin-java View Post
    That is a fairly decent break-down. Only caveat I would put on it is that the sex part is incorrect with respect to ball pythons (really, all pythons and boas if you want to be technical) as balls are X/Y and not the Z/W that Komodos are
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  17. The Following User Says Thank You to asplundii For This Useful Post:

    Bogertophis (06-17-2020)

Page 3 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1