Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,392

1 members and 3,391 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,100
Threads: 248,542
Posts: 2,568,763
Top Poster: JLC (31,651)
Welcome to our newest member, Scott L.
Page 1 of 2 12 LastLast
Results 1 to 10 of 12

Hybrid View

  1. #1
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Finally got some acid!

    I'm super excited to finally add some acid to my projects. Most agree acid/static/confusion are the same morph. I think they are going to be big in the hobby once the prices start to come down a little. I'm actually surprised they have held the high price tag this long but it is only a matter of time. Not sure if it will ever be as big as leopard but I think it definitely has the potential. Super excited to be in on it fairly early so I can hopefully be one of the breeders to show it's potential in new combos. He'll be added to at least my freeway and DG projects. I think he is an awesome example, love the busy pattern. He is acid pastel yb or acid reflux if you like. Can't wait for the weather to warm up a bit so I can have him in hand but for now the breeder photos are what I have to stare at. Hope you like.

    Sent from my SM-J737V using Tapatalk

  2. The Following 6 Users Say Thank You to rufretic For This Useful Post:

    Alicia (02-13-2020),Bogertophis (02-08-2020),Craiga 01453 (02-08-2020),Finn0208 (02-13-2020),Kam (02-09-2020),Lord Sorril (02-08-2020)

  3. #2
    Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,256
    Thanks
    28,180
    Thanked 19,841 Times in 11,853 Posts
    Really glad it's only a beautiful snake...
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  4. The Following 5 Users Say Thank You to Bogertophis For This Useful Post:

    Craiga 01453 (02-08-2020),Damien79 (02-13-2020),OkamiFlautist (02-12-2020),rufretic (02-08-2020),Southpaw91 (02-08-2020)

  5. #3
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Finally got some acid!

    Quote Originally Posted by Bogertophis View Post
    Really glad it's only a beautiful snake...

    Unfortunately it's more addictive!

  6. The Following User Says Thank You to rufretic For This Useful Post:

    Damien79 (02-13-2020)

  7. #4
    BPnet Senior Member
    Join Date
    02-20-2010
    Location
    United States
    Posts
    1,022
    Thanks
    312
    Thanked 906 Times in 405 Posts
    Images: 43

    Re: Finally got some acid!

    Very nice! I was looking into that project too, it has really good potential and hopefully I'll be able to get one eventually lol

    Sent from my LGL164VL using Tapatalk

  8. The Following User Says Thank You to Alexiel03 For This Useful Post:

    rufretic (02-09-2020)

  9. #5
    Registered User ceh23's Avatar
    Join Date
    10-28-2013
    Location
    VA
    Posts
    183
    Thanks
    27
    Thanked 96 Times in 73 Posts
    Images: 4
    Congrats! I have been looking at a few as well and close to pulling the trigger.....there will be some crazy combos out there and cannot wait to see the outcomes.
    https://www.morphmarket.com/us/searc...t=&layout=grid

    Instagram - CH_Reptiles_com
    My BPs -

    https://youtu.be/TZB9IFIq6-g - Albino and Coral Glow Pastel
    https://www.youtube.com/watch?v=yM612TpsTkk&t=7s - Pastel Lesser Het Clown
    https://youtu.be/XubMkeMBkPU - Killer Blast
    https://youtu.be/OF-x6Lt-OgQ - Super Pastel Het Clown
    https://youtu.be/XhbnRoMn1Sk - Pastel Clown

  10. The Following User Says Thank You to ceh23 For This Useful Post:

    rufretic (02-09-2020)

  11. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Finally got some acid!

    Welcome to the club

    Quote Originally Posted by rufretic View Post
    Most agree acid/static/confusion are the same morph.
    Small clarification; most of us working with Acid/Confusion/Static think that they are most likely allelic but not identical. Kind of along the lines of BlkPastel/Cinny/HRA - the differences are fairly subtle in the single gene form, but in combos it starts to become more obvious
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  12. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Godzilla78 (02-13-2020),JoeNapoli (08-30-2021),rufretic (02-11-2020)

  13. #7
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Finally got some acid!

    Quote Originally Posted by asplundii View Post
    Welcome to the club



    Small clarification; most of us working with Acid/Confusion/Static think that they are most likely allelic but not identical. Kind of along the lines of BlkPastel/Cinny/HRA - the differences are fairly subtle in the single gene form, but in combos it starts to become more obvious

    Thank you for the info on that subject. I'm obviously just getting my first so I have no first hand experience. I was going off what multiple breeders said in youtube videos, one was JKR so he is usually a pretty good source. For all I know he could of made a more recent video but in the videos I watched about them it was clearly stated that no differences have been observed. Maybe there is newer evidence now or maybe it will be like lesser/butter and cg/banana, not everyone agrees. All I know is I'm happy to have one of the lines and in fact my favorite of the three because trust me, I did a lot of research before I made the purchase, so I didn't just pick one that was the best deal or based on what somebody else said, I picked based on which one I liked the looks of better as a whole morph and then also as my favorite individual animal. I had extra in the budget but out of what was available, I liked my choice best. So I'm good whether they are the same or different. The only ones I've liked better are some of the confusion combos JKR has already came up with but that's not really a fair comparison vs mine that only has yb and pastel. I'm sure as more people work with it, there will be a more definite answer.
    Last edited by rufretic; 02-11-2020 at 09:06 PM.

  14. The Following 2 Users Say Thank You to rufretic For This Useful Post:

    Godzilla78 (02-13-2020),Lord Sorril (02-12-2020)

  15. #8
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Finally got some acid!

    Quote Originally Posted by asplundii View Post
    Welcome to the club



    Small clarification; most of us working with Acid/Confusion/Static think that they are most likely allelic but not identical. Kind of along the lines of BlkPastel/Cinny/HRA - the differences are fairly subtle in the single gene form, but in combos it starts to become more obvious
    One other thing while I have someone that works with them, has anyone made supers yet of any of the 3? I tried looking a while back and didn't come up with anything but I'd love to see how the super looks.

  16. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Finally got some acid!

    Quote Originally Posted by rufretic View Post
    Thank you for the info on that subject. I'm obviously just getting my first so I have no first hand experience. I was going off what multiple breeders said in youtube videos, one was JKR so he is usually a pretty good source. For all I know he could of made a more recent video but in the videos I watched about them it was clearly stated that no differences have been observed. Maybe there is newer evidence now or maybe it will be like lesser/butter and cg/banana, not everyone agrees.
    I do not say this as a dis on Justin because he does great stuff, but I do not feel he has looked in as deeply as some others of us have. And I have had short conversations with him some on FB in the Acid group and he acknowledged my take after I went into some detail.

    Really, the best way to see the divergence in them is to look at the combos. If you dig up Josh's Acid Pastel Spot and compare it to Justin's Confusion Pastel Spot and Fred's Pastel Spot Static you can see pretty clear differences. You see these same differences in the Lesser combos and the Pin combos.


    Quote Originally Posted by rufretic View Post
    The only ones I've liked better are some of the confusion combos JKR has already came up with but that's not really a fair comparison vs mine that only has yb and pastel. I'm sure as more people work with it, there will be a more definite answer.
    Justin and Josh have taken their projects in pretty different directions so it is hard to do a one to one comparison in terms of "best" combos. Personally, I am a huge Albino fan so I think Josh has taken the superior path LOL


    Quote Originally Posted by rufretic View Post
    has anyone made supers yet of any of the 3?
    To date both Josh and Justin have made clutches that could have produced them and no visually distinct superform has been made. It is possible some of the "high-expression" animals from those clutches are supers but we have to wait for those animals to be bred out which has not happened yet
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  17. #10
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Finally got some acid!

    Quote Originally Posted by asplundii View Post
    I do not say this as a dis on Justin because he does great stuff, but I do not feel he has looked in as deeply as some others of us have. And I have had short conversations with him some on FB in the Acid group and he acknowledged my take after I went into some detail.

    Really, the best way to see the divergence in them is to look at the combos. If you dig up Josh's Acid Pastel Spot and compare it to Justin's Confusion Pastel Spot and Fred's Pastel Spot Static you can see pretty clear differences. You see these same differences in the Lesser combos and the Pin combos.




    Justin and Josh have taken their projects in pretty different directions so it is hard to do a one to one comparison in terms of "best" combos. Personally, I am a huge Albino fan so I think Josh has taken the superior path LOL




    To date both Josh and Justin have made clutches that could have produced them and no visually distinct superform has been made. It is possible some of the "high-expression" animals from those clutches are supers but we have to wait for those animals to be bred out which has not happened yet
    Thank you again for making it a little clearer. I definitely don't doubt you because I know, sometimes the difference in some of these morphs is really hard to spot and there are many that some would think are the same at first look but as we have more animals to compare, the difference can be made more clear. I believe even if some of these morphs are just different lines of the same morph, the lines should be kept separate so as long as I know mine is acid, that's all I really care to worry about, I've chosen to work with acid

    As for the albino vs clown, that doesn't really concern me because my recessive of choice is desert ghost so expect to see acid DG combos in the near future

    Sent from my SM-J737V using Tapatalk

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1