Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,318

0 members and 3,318 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,100
Threads: 248,542
Posts: 2,568,763
Top Poster: JLC (31,651)
Welcome to our newest member, Scott L.
Page 2 of 2 FirstFirst 12
Results 11 to 13 of 13
  1. #11
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    6,952
    Thanks
    2,510
    Thanked 4,899 Times in 2,993 Posts

    Re: Snakes could be the source of the Wuhan coronavirus outbreak

    I thought they’d said it came from then eating bats ?!?!?


    Sent from my iPhone using Tapatalk Pro




  2. The Following User Says Thank You to Zincubus For This Useful Post:

    Sonny1318 (01-25-2020)

  3. #12
    bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,504
    Thanks
    2,891
    Thanked 9,865 Times in 4,781 Posts
    Images: 34

    Re: Snakes could be the source of the Wuhan coronavirus outbreak

    Bear in mind that SARS, swine flu, and avian influenza were also forms of coronavirus. I'd find it much more likely that the Wuhan coronavirus came from a mammal versus a reptile.

  4. The Following 2 Users Say Thank You to bcr229 For This Useful Post:

    Bogertophis (01-25-2020),Sonny1318 (01-25-2020)

  5. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Snakes could be the source of the Wuhan coronavirus outbreak

    Quote Originally Posted by Lord Sorril View Post
    Wuhan BSL-4 rated Virus Research Facility or Wuhan Exotic Meat Market--tough call figuring out the origin of this virus.
    If you are implying that this thing slipped the noose and is a rogue science experiment then I have some stock in tin foil I would be more than happy to sell you.

    Please do not contribute conspiracy theory ridiculous to the narrative. This is just one more case of spillover of a virus because of the nature of these markets and the culture in the region. The ultimate reservoir is going to be bats with a possible second mammalian host, just like SARS. Not a surprise because it is so closely related to SARS:

    http://virological.org/t/ncovs-relat...-snakes/331/20


    Quote Originally Posted by bcr229 View Post
    Bear in mind that SARS, swine flu, and avian influenza were also forms of coronavirus.
    Flu viruses are Paramyxoviruses, not Coronaviruses. So they are not even in the same phyllum as SARS and this new Coronavirus
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. The Following User Says Thank You to asplundii For This Useful Post:

    Bogertophis (01-27-2020)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1