Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,454

1 members and 3,453 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,096
Threads: 248,538
Posts: 2,568,732
Top Poster: JLC (31,651)
Welcome to our newest member, eamorris97
Results 1 to 4 of 4
  1. #1
    BPnet Veteran WrongPython's Avatar
    Join Date
    06-08-2019
    Posts
    545
    Thanks
    1,559
    Thanked 1,813 Times in 492 Posts

    Volta/sub-Saharan royals - any experience?

    I was listening to one of the many herp podcasts last night and heard mention of a "locality ball python" that was auctioned off recently. The only locality royals that I know of are the Voltas/sub-Saharans, which makes me think of them. The bit of reading I've done makes it sound like they have a few morphological differences from your average royal (massive size included). This makes me wonder if they may be a distinct population or even sub-species of P. regius.

    Does anyone here have experience keeping Volta/sub-Saharan royals? Better yet, does anyone here have a "pure locality" breeding project for them going on? It sounds like those that breed them are rather tight-lipped, as I've only ever seen wild-caught imports on the market.
    0.1 Sonoran Boa sigma​: "Adelita" ('19 Hypo het. leopard)
    1.0 Boa imperator longicauda: "Kuzco" ('19 het. anery)
    0.1 West Papuan Morelia spilota​: "Pandora" ('20)

  2. The Following User Says Thank You to WrongPython For This Useful Post:

    Scooda954 (01-28-2020)

  3. #2
    BPnet Senior Member Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    1,455
    Thanks
    622
    Thanked 3,197 Times in 1,091 Posts
    Images: 84

    Re: Volta/sub-Saharan royals - any experience?

    Several years ago: I knew a guy who got an adult Volta female (wild-caught) in a trade and his 'regular' males wouldn't cross with it (they freaked out and mashed their faces against the cage tops trying to escape). The female was chill. He asked me for breeding advice--I had nothing.
    *.* TNTC

  4. #3
    Registered User Scooda954's Avatar
    Join Date
    08-18-2018
    Posts
    22
    Thanks
    10
    Thanked 1 Time in 1 Post

    Re: Volta/sub-Saharan royals - any experience?

    Very good post I’m curious myself only replying to bump

  5. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Sub-Saharan is a misnomer, as the range for all ball pythons is"sub-Saharan".

    Volta is a locality that has tended to have larger animals. It is not a distinct sub-species. In the past there were a number of breeders out there that have worked with them but the majority of this hobby is driven by colour/pattern morphs so no one really cared enough about Volta-types to keep pure lineages of them. Mostly they were used to try and make bigger females that laid more eggs so that breeders could crank out larger clutches from their multi-gene males.

    The locality balls being auctioned off right now are not from Volta. I cannot remember off the top of my head where they are but they are part of the Southeast CarpetFest auction that is currently going on so you can search them out on there if you are so inclined (just follow/join the SECF page on Facebook). These specific animals are from Steven Tillis, who directly collected and imported them. There is nothing particularly unique about them morphologically, they are just known locality animals
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. The Following User Says Thank You to asplundii For This Useful Post:

    saldanasnakes (01-31-2020)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1