Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,373

0 members and 3,373 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,096
Threads: 248,538
Posts: 2,568,732
Top Poster: JLC (31,651)
Welcome to our newest member, eamorris97
Page 4 of 4 FirstFirst 1234
Results 31 to 31 of 31
  1. #31
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Spider Ball Python ban and breeding

    Quote Originally Posted by Stewart_Reptiles View Post
    Another irony most people that you will find against the spider gene have no issue with some dogs such as bulldogs, chihuahuas to name a few who have health issues and rarely can give birth naturally.
    I will take this further, pretty much every breed has some type of genetic baggage - labs and retrievers and German shepherds are prone to dysplasia, Aussie cattle dogs have ocular degeneration disease, etc. So if you keep/condone any type of pure-bred dog then you are being hypocritical
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 5 Users Say Thank You to asplundii For This Useful Post:

    Alicia (12-12-2019),ladywhipple02 (12-12-2019),PitOnTheProwl (12-12-2019),Stewart_Reptiles (12-12-2019),tickyyy (12-13-2019)

Page 4 of 4 FirstFirst 1234

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1