Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 477

13 members and 464 guests
Most users ever online was 6,337, 01-24-2020 at 03:30 AM.


» Today's Birthdays

» Stats

Members: 68,322
Threads: 242,832
Posts: 2,519,787
Top Poster: JLC (31,651)
Welcome to our newest member, rebccalim
Results 1 to 4 of 4
  1. #1
    Registered User Moose84's Avatar
    Join Date
    04-20-2019
    Posts
    287
    Thanks
    117
    Thanked 263 Times in 134 Posts

    Feeders in Northern Virginia

    I'm looking to see how many people in Northern Virginia are looking for / in need of live feeders or FT for that matter. As my collection grows I find it harder and harder to find a supplier to handle the collection. Nova is a populated area and I have a few ideas that could help out but I just need to find some others locally to bounce ideas off. If anyone is in the NOVA area and this sounds like something that interests you please let me know.

  2. #2
    Registered User
    Join Date
    07-07-2019
    Posts
    242
    Thanks
    9
    Thanked 157 Times in 115 Posts
    Check the book of face local market or VA rodent breeders. That's how I found my ASF an fancy rats. If you where on the Eastern Shore of VA I could hook you up
    Do you have the room for one or twp racks? You'd be set.
    Plans I used, but with 1/4" wire an I use hoppers to feed.
    http://www.arbreptiles.com/cages/rat_rack.html

  3. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    855
    Thanks
    91
    Thanked 639 Times in 342 Posts
    Where in NoVA are you?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #4
    Registered User Gocntry's Avatar
    Join Date
    05-28-2019
    Location
    Northern Va.
    Posts
    442
    Thanks
    333
    Thanked 571 Times in 269 Posts

    Re: Feeders in Northern Virginia

    I believe I'm close to you....

    I don't use live, and haven't had to yet (fingers crossed)

    I do use f/t, but just ordered 6 months worth from Perfect Prey, so I'm good for a while now, but do have 6 snakes to feed.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1