Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,351

0 members and 3,351 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,096
Threads: 248,538
Posts: 2,568,732
Top Poster: JLC (31,651)
Welcome to our newest member, eamorris97
Results 1 to 7 of 7
  1. #1
    Registered User
    Join Date
    11-04-2019
    Posts
    3
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Looking for Rubber Boa/Breeder

    Hello all. I am new to this site and really the herp community as a whole. A while back I became obsessed with getting my hands on a rubber boa. I love the stubby little guys but it has become apparent that they can be quite challenging to find, and are not that commonly kept by breeders. I have found one breeder but I wanted to see if any of you guys here could point me towards any potential leads. One thing that could make a difference is my location, I am located in Tennessee (in the US). Any assistance would be greatly appreciated and I wish you guys all the best.

    Thanks.

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I would advocate joining the rubber boa group on FB, there are a good number of keepers there and some of them offer their offspring up
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #3
    BPnet Veteran
    Join Date
    01-18-2018
    Posts
    649
    Thanks
    34
    Thanked 802 Times in 393 Posts

    Re: Looking for Rubber Boa/Breeder

    Quote Originally Posted by DingusKing View Post
    Hello all. I am new to this site and really the herp community as a whole. A while back I became obsessed with getting my hands on a rubber boa. I love the stubby little guys but it has become apparent that they can be quite challenging to find, and are not that commonly kept by breeders. I have found one breeder but I wanted to see if any of you guys here could point me towards any potential leads. One thing that could make a difference is my location, I am located in Tennessee (in the US). Any assistance would be greatly appreciated and I wish you guys all the best.

    Thanks.
    At one point I was also looking into rubber boas and tried to find a rubber boa breeder with no luck. Either the breeder stopped producing them or the business is gone. Can you please give me the name for the breeder? I think they are cool little sausages too, so maybe one day I will add them to my collection. I don't blame the breeders for wanting to quit though, some states won't let you keep them or sell them with or without a license; they are known for long periods of fasting and difficult to start feeding for babies; and many prefers the more affordable, rosy boa and KSB because they are easier to keep and work with and has more morphs available in the market.

  4. #4
    Registered User
    Join Date
    11-04-2019
    Posts
    3
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: Looking for Rubber Boa/Breeder

    Sure. The only one I've come across so far is Cold Blooded Thrillers on Facebook. They're sold out until fall 2020 so hopefully you're good with waiting, but unless I find another that's most likely who I'm gonna try to buy from. Plus, the person running the page is quite helpful and has been nothing but cordial the few times I have spoken with them. I'm not really a facebook user so there could very likely be others I have yet to come across.


    Also, to the previous response, I'll definitely check out the group. If you wouldn't mind though, could you post a link? There's a couple that pop up. Like I said before though, I'm not really a facebook user so I likely wont be the most active but it should at least give me a better shot at finding some people.
    Last edited by DingusKing; 11-05-2019 at 12:24 PM. Reason: added a left out part of a sentence

  5. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Looking for Rubber Boa/Breeder

    Quote Originally Posted by DingusKing View Post
    If you wouldn't mind though, could you post a link?
    I will try to remember when I get home (firewalls at work block all social media so I cannot get to it from here)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #6
    Registered User
    Join Date
    11-04-2019
    Posts
    3
    Thanks
    0
    Thanked 0 Times in 0 Posts
    So, a quick update: After much searching, I have found an individual that is selling their year old rubber boa and it hopefully will be mine very soon. I guess I should rename this thread or something now.

    Assuming I do get the little guy, I will post pictures when I can.

  7. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Congrats on finding one. Just a small word of warning, be ready for the fact that they should be gearing towards brumation right now so be prepared to just put it down for the winter rather than getting it all set up/geared up and expecting it to feed and crawl about and be all active

    Here is the group link: https://www.facebook.com/groups/1309...f=group_header
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1