Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,228

1 members and 3,227 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,095
Threads: 248,538
Posts: 2,568,726
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
Page 2 of 2 FirstFirst 12
Results 11 to 16 of 16

Thread: Rubber Boa’s

  1. #11
    BPnet Veteran NewmanLovesSnakes's Avatar
    Join Date
    06-23-2019
    Location
    Dodson, LA
    Posts
    250
    Thanks
    499
    Thanked 237 Times in 122 Posts

    Re: Rubber Boa’s

    Quote Originally Posted by Bogertophis View Post
    Unless you're talking about a really BIG snake (whose longer teeth + strength w/ tearing motion in worst case scenario like a feeding bite can & have sometimes resulted
    in lasting nerve damage), or venomous snake (don't even go there), the bites from any typical harmless pet snake is NOT any big deal. They happen fast, & those little
    teeth make an ouch much like getting an injection at the doctor...it's over before you know it & heals fast, rarely ever getting infected, even without treatment.

    But a bite won't endear a snake to family members that are at all afraid of snakes...so bites are best avoided for them. To be successful in handling snakes, you need to
    be able to relax, & fear just works against you. I'm not saying that snakes "smell fear" or any such thing...I just know from my own experience that trust is a 2-way street.
    I don’t think I will mind being bit, I definitely don’t fear it like I would with a big constrictor or a venomous snake. My wife is the toughest woman I’ve ever met so though I don’t want her to get bit, if she did she would shrug that off so quick. I think sometimes she has a higher pain tolerance than me lol


    Sent from my iPhone using Tapatalk

  2. #12
    Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,249
    Thanks
    28,167
    Thanked 19,829 Times in 11,846 Posts
    Most women do deal with pain better than men... (we don't have a choice) and for anyone (man or woman) who has ever done a
    little hand-sewing & poked their finger with a needle or a pin, they already "know" what snake teeth feel like. Not the end of the world.
    Last edited by Bogertophis; 07-31-2019 at 10:02 PM.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  3. The Following 2 Users Say Thank You to Bogertophis For This Useful Post:

    NewmanLovesSnakes (08-01-2019),Spicey (06-22-2021)

  4. #13
    Registered User
    Join Date
    06-19-2021
    Posts
    2
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: Rubber Boa’s

    Quote Originally Posted by NewmanLovesSnakes View Post
    I found a nice breeder on Facebook who’s got some great reviews if you want his info btw, he charges $275 for Rubbers and he should have them in stock soon.
    Sorry to butt in, but I've also been researching rubber boas - I've got one myself, but have been struggling to find a second (as I want a pair to breed them down the road). Would you mind sharing the info for that seller? I've found breeders insanely hard to find, outside of Zerkle Reptiles (where I got my first one)!

  5. #14
    Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,249
    Thanks
    28,167
    Thanked 19,829 Times in 11,846 Posts

    Re: Rubber Boa’s

    Quote Originally Posted by mcarlson View Post
    Sorry to butt in, but I've also been researching rubber boas - I've got one myself, but have been struggling to find a second (as I want a pair to breed them down the road). Would you mind sharing the info for that seller? I've found breeders insanely hard to find, outside of Zerkle Reptiles (where I got my first one)!
    I haven't seen "Newman" around much these days- you might have better luck with a PM to him?
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  6. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Rubber Boa’s

    Try checking in with Mike Schultz over at RL Exotics. He had some at the Schaumberg show this past weekend. Not sure he has any left but you might get lucky
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (06-22-2021),nikkubus (06-22-2021)

  8. #16
    Registered User
    Join Date
    06-19-2021
    Posts
    2
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: Rubber Boa’s

    Quote Originally Posted by Bogertophis View Post
    I haven't seen "Newman" around much these days- you might have better luck with a PM to him?
    Good to know! I just did that I'm pretty clumsy and new on these forums, so the advice was much appreciated!

    - - - Updated - - -

    Quote Originally Posted by asplundii View Post
    Try checking in with Mike Schultz over at RL Exotics. He had some at the Schaumberg show this past weekend. Not sure he has any left but you might get lucky
    Sweet! Ironically, I think I saw a photo of their snakes (because I remember the show name), but couldn't for the life of me find out who the seller was until now! So this is wonderful, thank you.

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1