» Site Navigation
2 members and 3,155 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,095
Threads: 248,538
Posts: 2,568,726
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
|
-
I've been extremely partial to the Parasaurolophus for most of my life- I believe it's a pretty popular dinosaur, and yet I never hear of anyone else describing it as their favorite. Perhaps it's just frequently depicted in toys and paleo-art because it looks so funky, which is absolutely fine with me!
I was hardcore into dinosaurs as a kid, and, until about 7th grade, aspired to become a paleontologist. I was also a bit of a pretentious pud, and was likely highly attracted to this particular dinosaur specifically because it was too hard for most other kids to pronounce.
1.0 Banana/Coral Glow Emperor Pin BP- Horatio
0.1 Hypo Black Pewter Butter- Gin & Tonic (Ginny)
1.0 Piebald Cat- Percival Henry
-
-
Re: What Are Your Favorite Dinosaurs?
when i was little i was convinced i was a brontosaurus so that one i guess lol
Sent from my SM-G950U using Tapatalk
Gargoyle Geckos: Gorey, Gremmie, Ouija, Gojira, Bacon Bit, Penny, Wednesday
Crested Geckos: Eggs, Triscuit, Creature & Waffles
Leopard Geckos: Rhubarb, Pepper and Clementine
Cal Kings: Bones & Violet
Corn snakes: A sh*tload
Trans-Pesos: 1.1 No names
BPs: Charlie (super pastel), Bodhi (pied), Finn (GHI Mojave), Dublin (fire bumblebee), Falkor(mystic potion), Letty (pewter), Jameson
BCI Boa: Specter (Fineline morph)
SnuSnu the cat, Corbin the pit bull, Juniper the mini aussie & Lily the setter mix
One little special needs bearded dragon P. Sherman
Black African House Snakes: 1.1 No names
Northern Pines: 1.1 No names
Four skinks, one of which is named Gator & Basil the mini-lop rabbit
'everything was beautiful and nothing hurt' - vonnegut.
www.facebook.com/SilentHillReptiles
-
-
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: What Are Your Favorite Dinosaurs?
My absolute favorite dinosaur is the Carnotaurus My other favorites include spinosaurus, giganotosaurus, suchomimus, Baryonyx.
I've always loved dinosaurs since I was little, I had so many books on them and read them non stop along with books on birds, sharks and whales
Sent from my LGL164VL using Tapatalk
-
-
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|