» Site Navigation
2 members and 3,294 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,095
Threads: 248,538
Posts: 2,568,725
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
|
-
Re: A Breeder jumped down my throat at Tinley...
Originally Posted by pbenner
I listened to this on the start of my ride down to Texas. Exactly what I was looking for. Thank you so much.
Paul
Glad to be of help
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
As for parthenogenesis, a female will produce exact copies of herself, with the lack of male presence. If at any time a male was introduced to that female it is extremely unlikely the clutch would be a partho clutch unless all the babies were exact copies of the mother, which could still happen when bred normally.
It would not be possible for a pastel female to make super pastels by partho. The male was probably just low quality pastel or the female could have been a low quality super.
- - - Updated - - -
Also, what part of Texas are you moving to? I'm up in Wichita Falls.
-
-
Re: A Breeder jumped down my throat at Tinley...
Originally Posted by Eramyl
As for parthenogenesis, a female will produce exact copies of herself, with the lack of male presence. If at any time a male was introduced to that female it is extremely unlikely the clutch would be a partho clutch unless all the babies were exact copies of the mother, which could still happen when bred normally.
It would not be possible for a pastel female to make super pastels by partho. The male was probably just low quality pastel or the female could have been a low quality super.
- - - Updated - - -
Also, what part of Texas are you moving to? I'm up in Wichita Falls.
Well, based on information I have since gathered I am convinced that the guy in question didn't quite understand what he was trying to teach or discuss. Even if he did he couldn't put it into a cohesive structure.
I'm not going to get into a debate about something I barely have a toothpick to stand on.
In regards to where; I drove through Wichita Falls early this morning. I live in Brady now. I saw there was a show up there a while back, but opted not to go.
Best,
Paul
-
-
Re: A Breeder jumped down my throat at Tinley...
Originally Posted by pbenner
My apologies. I honestly had no clue. No offense intended!
Don't sweat it, Paul. You're not the 1st as I've done the exact same thing. I think if BogerChic would (cough) post a pic (cough) then maybe we wouldn't be so quick to say otherwise.
-
The Following 2 Users Say Thank You to Shayne For This Useful Post:
JRLongton (03-20-2019),Toad37 (03-20-2019)
-
Re: A Breeder jumped down my throat at Tinley...
I've been on both sides of genetics lectures, so I sympathize with both sides. Nevertheless, there is a time and place for them, and a reptile sale probably isn't either.
To answer the codominant question, here is a quote:
"In his law of dominance, Mendel did not accommodate different degrees of dominance. As such examples were discovered (Bateson 1913), various new terms were introduced. Within and between textbooks of genetics definitions are inconsistent. Various names have been used: partial dominance, incomplete dominance, codominance, lack or absence of dominance, intermediate dominance, imperfect dominance, egalitarian dominance, and transdominance. The definitions vary from text to text and depend on interpretation of allelic function, although an allele’s function is seldom known and often must be assumed. In all these usages there is one consistent aspect; each genotype has a distinguishable phenotype, and the genotype may be inferred from the phenotype. Perhaps none of the terms that have been used are all-inclusive, but some such term is desirable for teaching purposes. We have chosen the term codominance as simplest, shortest, and adequately inclusive. One can still use specialized sub-definitions for well-analyzed cases. In our more that 20 years of teaching this method has worked well."
From Miller, W. J. and Hollander, W. F., 1995, Three neglected advances in classical genetics, BioScience 45: 98-104. Available on Miller's web site, www.ringneckdove.com.
Any breeder would probably find the whole paper worth reading.
-
The Following 2 Users Say Thank You to paulh For This Useful Post:
Dianne (03-19-2019),JRLongton (03-20-2019)
-
That was the first show we have had up here. The vendors had some cool stuff but not a lot pf people buying just yet. Saw a lot of curious kids and scared parents handling animals though. Hopefully it'll get things going up here. I'm glad your trip wasn't eventful.
-
-
Re: A Breeder jumped down my throat at Tinley...
Originally Posted by Eramyl
As for parthenogenesis, a female will produce exact copies of herself, with the lack of male presence. If at any time a male was introduced to that female it is extremely unlikely the clutch would be a partho clutch unless all the babies were exact copies of the mother, which could still happen when bred normally.
It would not be possible for a pastel female to make super pastels by partho. The male was probably just low quality pastel or the female could have been a low quality super..
That is not correct Eramyl. In parthenogenesis the female produces half-clones of herself so a female Pastel that threw a partho clutch would produce only SuperPastels and normals.
And it is also very possible for females to throw partho clutches when exposed to males. I have an animal that has done it at least twice and Warren Booth has documented a slew of cases
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: A Breeder jumped down my throat at Tinley...
Originally Posted by asplundii
That is not correct Eramyl. In parthenogenesis the female produces half-clones of herself so a female Pastel that threw a partho clutch would produce only SuperPastels and normals.
And it is also very possible for females to throw partho clutches when exposed to males. I have an animal that has done it at least twice and Warren Booth has documented a slew of cases
I thought that this was the case as well, but like I said, I am not far enough along in my understanding to try to stand up in this argument.
-
-
Re: A Breeder jumped down my throat at Tinley...
Originally Posted by pbenner
I listened to this on the start of my ride down to Texas. Exactly what I was looking for. Thank you so much.
Paul
What part of Texas? I am south of Houston. If close enough we should have a herping day where we share the love of our animals.
-
-
Re: A Breeder jumped down my throat at Tinley...
Originally Posted by Skyrivers
What part of Texas? I am south of Houston. If close enough we should have a herping day where we share the love of our animals.
I'm in Brady, Tx - I'll be headed to San Antonio for the show at the end of the month if you want to meet up on Saturday. I'll be doing quite a few others just to get out of a town of 5500 people on the regular. lol
Paul
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|