Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,291

2 members and 3,289 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,095
Threads: 248,538
Posts: 2,568,728
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
Page 2 of 2 FirstFirst 12
Results 11 to 19 of 19
  1. #11
    Registered User Roux's Avatar
    Join Date
    06-22-2017
    Posts
    136
    Thanks
    40
    Thanked 70 Times in 52 Posts

    Re: BP morph ID please?

    I looked up the breeders fb page, and that particular snake you have came from a pairing that was spotnose ghi to spotnose hra. Without a doubt your snake has spotnose in it. They even have pictures of the full clutch after hatching ect.
    I see no reason to doubt the morphs they listed for your snake.


    Sent from my SM-N960U using Tapatalk

  2. The Following User Says Thank You to Roux For This Useful Post:

    Shadowy (02-28-2019)

  3. #12
    Registered User ShawarmaPoutine's Avatar
    Join Date
    07-05-2018
    Posts
    128
    Thanks
    77
    Thanked 60 Times in 39 Posts
    Images: 2

    Re: BP morph ID please?

    Quote Originally Posted by Roux View Post
    I looked up the breeders fb page, and that particular snake you have came from a pairing that was spotnose ghi to spotnose hra. Without a doubt your snake has spotnose in it. They even have pictures of the full clutch after hatching ect.
    I see no reason to doubt the morphs they listed for your snake.


    Sent from my SM-N960U using Tapatalk
    Roux saves the day.

  4. #13
    Registered User Shadowy's Avatar
    Join Date
    01-07-2019
    Location
    Washington State
    Posts
    125
    Thanks
    82
    Thanked 134 Times in 44 Posts
    Images: 30

    Re: BP morph ID please?

    Quote Originally Posted by Roux View Post
    I looked up the breeders fb page, and that particular snake you have came from a pairing that was spotnose ghi to spotnose hra. Without a doubt your snake has spotnose in it. They even have pictures of the full clutch after hatching ect.
    I see no reason to doubt the morphs they listed for your snake.


    Sent from my SM-N960U using Tapatalk
    I did not even think to do that! You’re amazing!
    Thank you so much, very relieved to know when I breed in a couple years I have the possibility of getting a super GHI.
    _______________________________________


    _______________________________________

  5. #14
    Registered User Roux's Avatar
    Join Date
    06-22-2017
    Posts
    136
    Thanks
    40
    Thanked 70 Times in 52 Posts

    Re: BP morph ID please?

    Very glad i could help! i go to the extreme when researching... morph market really provides a lot of info if you dig for it!

    Sent from my SM-N960U using Tapatalk

  6. #15
    BPnet Senior Member Sunnieskys's Avatar
    Join Date
    05-13-2017
    Location
    Seattle, WA
    Posts
    2,471
    Thanks
    913
    Thanked 1,694 Times in 1,076 Posts
    Images: 2
    I have a HRA and the stripe down the back looks like mine. It's pretty distinctive.

    thats a pretty snake.
    ~Sunny~
    Booplesnoop
    Coilsome, Odyn, & Eeden AKA theLittleOne

    0:1 Pastel Het Red Day Chocolate
    1:0 Normal
    0:0:1 Pueblan milk snake

    *~* Nothing sticky (tape, stick on gauges, Velcro) goes into your enclosure! Again...NOTHING sticky goes into your enclosure....EVER! *~*

  7. #16
    BPnet Veteran Mr.Spence's Avatar
    Join Date
    02-28-2012
    Posts
    415
    Thanks
    108
    Thanked 228 Times in 170 Posts
    Images: 86

    Re: BP morph ID please?

    Quote Originally Posted by Shadowy View Post
    KDF Reptiles LLC. Breeder in Texas. I do trust the breeder but after looking at other BPs with GHI I was questioning it.
    Kevin is a good dude and one I would not hesitate to do business with. Also, if you'll look at the pics you provided you'll notice that at the back of the head right before the stripe begins on the neck there is a little light colored "dash" running length wise. All of the Spotnose GHI's I've hatched or seen as well as combo's like spotnose lesser ghi have that marking.

  8. #17
    Registered User Shadowy's Avatar
    Join Date
    01-07-2019
    Location
    Washington State
    Posts
    125
    Thanks
    82
    Thanked 134 Times in 44 Posts
    Images: 30

    Re: BP morph ID please?

    Quote Originally Posted by Mr.Spence View Post
    Kevin is a good dude and one I would not hesitate to do business with. Also, if you'll look at the pics you provided you'll notice that at the back of the head right before the stripe begins on the neck there is a little light colored "dash" running length wise. All of the Spotnose GHI's I've hatched or seen as well as combo's like spotnose lesser ghi have that marking.
    Thank you! I wasn’t questioning him to begin with. He really seemed like he knew his stuff when I bought from him. After posting a picture on reddit and few people pointed out she looked like a normal, I just had to make sure. Shame on me for listening to people on reddit. Lol
    _______________________________________


    _______________________________________

  9. #18
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: BP morph ID please?

    Quote Originally Posted by Roux View Post
    I looked up the breeders fb page, and that particular snake you have came from a pairing that was spotnose ghi to spotnose hra. Without a doubt your snake has spotnose in it.
    Just a point of clarification, that pairing does not guarantee "without a doubt" that the animal is a Spotnose. There is, for any given offspring, a 1:4 chance of it not having the Spotnose gene.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. The Following User Says Thank You to asplundii For This Useful Post:

    dr del (03-02-2019)

  11. #19
    Registered User Roux's Avatar
    Join Date
    06-22-2017
    Posts
    136
    Thanks
    40
    Thanked 70 Times in 52 Posts

    Re: BP morph ID please?

    Quote Originally Posted by asplundii View Post
    Just a point of clarification, that pairing does not guarantee "without a doubt" that the animal is a Spotnose. There is, for any given offspring, a 1:4 chance of it not having the Spotnose gene.
    My mistake, you are indeed correct. Should have double checked myself before saying so.

    Sent from my SM-N960U using Tapatalk

  12. The Following User Says Thank You to Roux For This Useful Post:

    asplundii (03-04-2019)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1