Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,217

2 members and 3,215 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,095
Threads: 248,538
Posts: 2,568,726
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
Results 1 to 3 of 3

Thread: Gypsy Gene??

  1. #1
    Registered User Scale.Envy's Avatar
    Join Date
    01-29-2017
    Location
    SC
    Posts
    11
    Thanks
    10
    Thanked 8 Times in 4 Posts

    Gypsy Gene??

    Hi all! I haven't seen much about the gypsy gene and I came across someone selling a pair. I don't know what kind of price they usually go for as I have never seen this gene for sale yet, so I don't know what to compare it to. I have only seen about 4 pictures, so if anyone has pics to share that would be awesome so I can see how it acts in combos. I appreciate any input!

    Vyki
    FB: Scale Envy
    IG: Scale Envy

    1) 0.1 Tiger (April)
    2) 1.0 Super Specter Banana (Makai)
    3) 1.0 Banana Cinnamon (Huckleberry)
    4) 1.0 Specter het Clown (Oxford)
    5) 0.1 Black Pastel Specter (Calliope)
    6) 1.0 Trick (Loki)
    7) 0.1 Cinnamon Mojave (Persephone)
    8) 1.0 Lesser (Micco)
    9) 0.1 Spotnose (Delilah)
    10) 0.1 Import (Issa)
    11) 1.0 Lori (Orion)
    12) 0.1 Specter (Clove)
    13) 0.1 Granite Yellow Belly (Dahlia)
    14) 1.0 Spotnose Vanilla (Misha)
    15) 1.0 Enchi Specter (Amaretto)
    16) 1.0 Arroyo (Thorn)
    17) 0.1 Pinstripe (Pickles)
    18) 0.1 Arroyo (Thistle)
    19) 0.1 Lesser Spotnose (Magnolia)
    20) 0.1 Lesser Spotnose (Orchid)
    21) 1.0 Spotnose (Pretzel)
    22) 0.1 Lesser (Penelope)
    23) 1.0 Calico Leopard (Asmodeus)
    24) 0.1 Lori (Andromeda)
    25) 1.0 Normal (Rescue)

  2. #2
    BPnet Senior Member Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    1,455
    Thanks
    622
    Thanked 3,197 Times in 1,091 Posts
    Images: 84

    Re: Gypsy Gene??

    I think I saw one once (if I remember correctly): it reminded me of a black pastel patterning (linked multiple cheerios: without the speckles) with a weird cinnamonish hue? Does that sound right? The one I saw was NFS a few years back at an expo. At the time I figured it was one of 'those' line bred morphs that people gave a new name to make themselves feel special.

    I imagine the color would react like a Cinnamon and the pattern similar to a Black Pastel...but I could not say for certain. Since the morph is at least a few years old and I haven't seen one since: It makes me think it has limited potential.
    *.* TNTC

  3. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    It was discovered/originated by Josh Baity (formerly of HerpNation Radio podcast). It is in the BlkPastel complex of genes, best comparison to existing morphs in that group would be the Lori in terms of how it looks and behaves in combos
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following User Says Thank You to asplundii For This Useful Post:

    dr del (01-03-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1