» Site Navigation
6 members and 3,466 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,096
Threads: 248,539
Posts: 2,568,735
Top Poster: JLC (31,651)
|
-
Re: Paradox genetics
So...After doing some more research, as a friend of mine always says “Google is your friend”. I found several (read that as three that I read) articles about leucistic animals. Not searching for just ball pythons helped. They all stated that it doesn’t always effect the color of the whole animal. So...mystery solved. I also read about chimeras and in many animals they aren’t as uncommon as once thought, even in humans. So, that’s also a possibility in some cases. Guess I’ll have to keep looking for the golden ball.
But, similar to Super Fires that tend to throw babies with more yellow, possibly mine have more wild type color patches. I guess I have that going for me!
-
-
BPnet Veteran
Re: Paradox genetics
Originally Posted by Hannahshissyfix
I think it's just random but it does seem certain morphs have more paradox markings pop up more frequently. That may be because they are morphs I tend to look up more often or that they are more popular genes in general.
Sent from my SM-G920T using Tapatalk
I guess that would be the next question .. is there a morph (pied - which i see the most of with paradox) that this shows up in more often then others or is it as spontanious as most people who deal with the morph say, its hit or miss...idk, and that y im reading lol
-
The Following User Says Thank You to Ronniex2 For This Useful Post:
-
Re: Paradox genetics
Originally Posted by paulh
As I understand it, a paradox starts as a fertilized double-yolked egg, and the two fuse early in embryonic life. So it is a case of twins that became one snake. From what I have read, double-yolked eggs tend to run in families, but it is not a trait caused by a single Mendelian gene. And double-yolked eggs are more common in species with large eggs, like ball pythons and Burmese pythons.
I had a bullsnake that produced occassional eggs that I believe were double yolked simply from the size (twice as long and nearly as wide as a normal egg). The babies from those eggs may have been chimeras (with cell lines from each of the two fertilized eggs), but those babies were not paradoxes because they were normals, like both parents. A paradox is a chimera whose cell lines produce different appearances so they can be distinguished.
A paradox male does not produce eggs, so he may pass on a tendency to produce double-yolked eggs to his female offspring, but that doesn't affect his mate. A paradox female may produce another paradox, if she produces a double-yolked egg. And if the color genetics are right in her and her mate.
Originally Posted by skydnay
Jumping back to this, you're referring to a chimera, where one animal contain, more or less, the mashed together DNA of two animals. So, this begs the question, are chimerism and paradoxing the same thing? If so, then this wouldn't necessarily be something you can breed for.
However, I'm almost convinced they're not the same.
...
I have also noticed and agree that paradoxing seems much more common on morphs that minimize pigmentation, so it appears that these are patches where the pigment actually expresses. Given these, it appears that chimera and paradox are two different expressions. They visually express very differently.
Still, I'm not sure that either of these can be bred for consistently.
that's also my skool of thought of Chimera-Paradox. in terms of expression, the Chimera could look like 2 (of more) diff designer morphs - like a Highway w/ an Albino ringers. Paradox is mostly expressed as 1 designer morph and patches of wild type patterning.
anyways here's a few on mines:
Edit:
Originally Posted by Hannahshissyfix
I think it's just random but it does seem certain morphs have more paradox markings pop up more frequently. That may be because they are morphs I tend to look up more often or that they are more popular genes in general.
Originally Posted by Ronniex2
I guess that would be the next question .. is there a morph (pied - which i see the most of with paradox) that this shows up in more often then others or is it as spontanious as most people who deal with the morph say, its hit or miss...idk, and that y im reading lol
i've noticed paradoxing more in BEL's, Champagnes and Banana's. i don't see them often in Pieds and when i do it's usually just a big black spot.
Last edited by Ax01; 09-13-2018 at 03:40 PM.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following 2 Users Say Thank You to Ax01 For This Useful Post:
LotsaBalls (09-13-2018),Ronniex2 (09-14-2018)
-
Re: Paradox genetics
Originally Posted by skydnay
Jumping back to this, you're referring to a chimera, where one animal contain, more or less, the mashed together DNA of two animals. So, this begs the question, are chimerism and paradoxing the same thing? If so, then this wouldn't necessarily be something you can breed for.
However, I'm almost convinced they're not the same. Take a look at these two snakes, both owned by Taylor Nicole Dean:
This is Gemini, who is a chimera.
From what I've seen, this is how chimeras tend to appear, with a visible distinction between the 2 sets of genetics.
On the other hand, this is Frank:
Frank is more what is expected of a paradox, with splotching and banding of pigment visible.
I have also noticed and agree that paradoxing seems much more common on morphs that minimize pigmentation, so it appears that these are patches where the pigment actually expresses. Given these, it appears that chimera and paradox are two different expressions. They visually express very differently.
Still, I'm not sure that either of these can be bred for consistently.
A chimera does NOT have the mashed together DNA of two different animals. A chimera has the CELLS of two different animals. The cells have not been mashed together enough to make two cells into one cell. The cells are only mashed together enough to make them grow into a single animal. A given cell has the DNA of either one or the other original fertilized egg. The DNA of that cell is identical to the DNA of the progenitor fertilized egg.
Gemini is one cool snake! IMHO, both Gemini and Frank are paradoxes.
A paradox is a chimera plus. A paradox has cell lines of two different animals plus the genetics of those two animals is different enough to identify that cell lines come from two different animals.
I agree that paradoxing seems much more common on morphs that minimize pigmentation. But I think that is the result of the number of morphs that minimize pigmentation. I think that a paradox could occur if a pinstripe and a normal became a chimera.
IMHO, there are a lot more chimeras out there than there are paradoxes. Many chimeras are never identified as chimeras because they are not paradoxes. And I also think that chimeras and paradoxes cannot be bred for consistently. Either in an expected percentage of babies or in number, size or distribution of markings.
Originally Posted by Ax01
that's also my skool of thought of Chimera-Paradox. in terms of expression, the Chimera could look like 2 (of more) diff designer morphs - like a Highway w/ an Albino ringers. Paradox is mostly expressed as 1 designer morph and patches of wild type patterning.
....
IMHO, a chimera could look normal or be a designer morph. It is likely to go unidentified as a chimera. A paradox is a chimera plus, with patches of different morphs or patches of a morph and normal. For example, if a male mojave was bred to a female lesser, a paradox could be a chimera where one fertilized egg had the genetics of a mojave/lesser BEL and the other had the genetics of a normal. A paradox would also result if one fertilized egg had the genetics of a mojave/lesser BEL and the other had the genetics of a mojave. A simple chimera would result from this mating if both fertilized eggs were normals, were mojaves, were lessers, or were mojave/lessers.
-
The Following User Says Thank You to paulh For This Useful Post:
-
Re: Paradox genetics
Originally Posted by Ronniex2
I guess that would be the next question .. is there a morph (pied - which i see the most of with paradox) that this shows up in more often then others or is it as spontanious as most people who deal with the morph say, its hit or miss...idk, and that y im reading lol
Champagne definitely seems to be one of the bigger ones seen, and banana definitely has its share.
-
The Following User Says Thank You to chakup For This Useful Post:
-
I swore I was not going to get into this but...
Originally Posted by skydnay
Jumping back to this, you're referring to a chimera, where one animal contain, more or less, the mashed together DNA of two animals. So, this begs the question, are chimerism and paradoxing the same thing? If so, then this wouldn't necessarily be something you can breed for.
Originally Posted by paulh
A chimera does NOT have the mashed together DNA of two different animals. A chimera has the CELLS of two different animals. The cells have not been mashed together enough to make two cells into one cell. The cells are only mashed together enough to make them grow into a single animal. A given cell has the DNA of either one or the other original fertilized egg. The DNA of that cell is identical to the DNA of the progenitor fertilized egg.
Neither of these are quite correct but Paul is close.
A chimera is when an individual has cells with two distinct genetic populations within their bodies. In many cases this occurs when two genetically distinct zygotes fuse and then go on to develop into a single viable embryo, however there are other mechanisms by which this can happen.
Originally Posted by paulh
A paradox is a chimera plus. A paradox has cell lines of two different animals plus the genetics of those two animals is different enough to identify that cell lines come from two different animals.
This is not correct.
First off we need to establish something that I have said numerous times on many different platforms (and which seems to be consistently ignored):
"Paradox" is a completely ILLIGITIMATE term used within the hobby that has zero scientific meaning.
Please go back and read that sentence again.
Within the hobby the term "paradox" is used to describe any animal displaying areas of pigmentation/pattern that are contrary to the accepted base morph of the animal. So, in terms of pigmentation, an Albino animal with a patch of normal melanin pigmented skin would be "paradox" and, flipping it around, a normal-coloured animal with an Albino-like amelanistic patch would also be "paradox". A pattern-type "paradox" would be a Spider with a patch of WT patterning on it or, flip side, a WT with a patch of Spider pattern.
So... Is a chimera a "paradox"? Yes. And a mosaic is also a "paradox". And a localized chromosomal disjunction giving rise to a population of monoallelic cells is also a "paradox". And reactivation of a gene through the excision of a transposon is also a "paradox". And all the other strange and bizarre genetic foibles that can give rise to atypical localized pigment/pattern display are all also "paradox".
As far as whether or not "paradox" is a breedable trait... Never say never as they say. But given that there are numerous different mechanisms that can give rise to a "paradox" phenotype (a few of which I listed above) and that most of them are fluke occurrences, I think the odds are against it. That said, there are the reported Whitewash and Atomic animals however, neither of these has been proven and the originators of both of these projects have gone rather silent on them. And I will also note that there are the "paradox" KSBs, however I know nothing about them other than that there does appear to be some consistency in their production.
Last edited by asplundii; 09-14-2018 at 10:54 AM.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 5 Users Say Thank You to asplundii For This Useful Post:
Ax01 (09-14-2018),jbrumley4201 (09-14-2018),LotsaBalls (09-14-2018),paulh (09-15-2018),skydnay (09-14-2018)
-
Re: Paradox genetics
Originally Posted by asplundii
As far as whether or not "paradox" is a breedable trait... Never say never as they say. But given that there are numerous different mechanisms that can give rise to a "paradox" phenotype (a few of which I listed above) and that most of them are fluke occurrences, I think the odds are against it. That said, there are the reported Whitewash and Atomic animals however, neither of these has been proven and the originators of both of these projects have gone rather silent on them. And I will also note that there are the "paradox" KSBs, however I know nothing about them other than that there does appear to be some consistency in their production.
Ahhhh! That was quite the informative read!
I agree with you on breedibility, and was basically trying to say the same thing. In ball pythons, in the least, it seems to be just random. Maybe some lines or genes are more prone to it happening, but I doubt it will ever be something you could consistently breed for.
KSBs on the other hand... I dont know a whole lot about their genetics, but it seems that the paradoxing CAN be consistently bred for. I have an albino paradox KSB, and while I was speaking with the breeder, I was told that the paradoxing is related to her particular line of albinism. So each albino in the line has paradox patterning. Important to note, the paradoxing isn't the same across individuals, just that they all express it.
Very interesting.
Sent from my SM-G950U1 using Tapatalk
Ball Pythons!
1.0 Normal - Echo
1.0 Spider Enchi Ghost - Whiskey
0.1 Super Pastel Lesser - Tango
1.0 Butter Spider Het Hypo - Foxtrot
Other Snakes!
0.1 Albino Paradox KSB - Socks
1.0 Jungle Carpet Python - JPEG
1.0 California Kingsnake - Salazar
Geckos!
0.2 Super Hypo Tangerine Leos - Riddle and Valkyrie
-
The Following User Says Thank You to skydnay For This Useful Post:
-
BPnet Veteran
Re: Paradox genetics
Ok ... well as I have done no research but reading what you guys saying g but super interesting and insightful... so I figured I’d post this like skyrivers did with the Great Dane ... I jus thought it was cool
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to Ronniex2 For This Useful Post:
-
Re: Paradox genetics
Awesome read. I do think there are several different things going on that fall under the industry term paradox. Would be interesting to know more about the parents of some of the different types to figure out what genetics are involved even if not actually causing the paradox appearance. For ones to fall under the chimera theory it would have to be a pairing that could produce the two different types of offspring to get merged into one animal. The first paradoxes I remember seeing were albino and at the time that was the only morph that had large numbers of clutches that could have both morphs and normals. But even then you would see some that looked like part albino and part normal and others that looked like albinos that had some darker than normal areas.
I'm wondering if this one I recently hatched could be something different than a chimera; maybe just birth defect or some sort of localized genetic anomaly. I wasn't aware of either parent having any type of axanthic gene and none of the siblings was axanthic. But I still have a little hope that whatever happened exposed that maybe I have the axanthic gene and this exposed that this male is a het with localized areas where genetic anomalies allowed the het axanthic to show through so I'm thinking of keeping him as a breeder. I was wanting to upgrade to a pied male anyway so as long as he doesn't turn out to be infertile suppose worth a try.
-
The Following User Says Thank You to RandyRemington For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|