Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,286

0 members and 3,286 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,095
Threads: 248,538
Posts: 2,568,726
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
Page 2 of 2 FirstFirst 12
Results 11 to 18 of 18
  1. #11
    Sometimes It Hurts... PitOnTheProwl's Avatar
    Join Date
    11-21-2010
    Location
    San Antonio, TX
    Posts
    12,050
    Thanks
    6,313
    Thanked 6,985 Times in 4,274 Posts
    Images: 3

    Re: Would you feed a ribbon snake to a king snake?

    Quote Originally Posted by Zincubus View Post
    Please don't ... I have enough trouble coping with the idea of snakes being fed live mice and rats ..
    Guess you don't want to know what I do with balls that need to be culled.......... I love my MBKs

  2. The Following 6 Users Say Thank You to PitOnTheProwl For This Useful Post:

    C.Marie (08-10-2018),Craiga 01453 (08-10-2018),jmcrook (08-10-2018),MissterDog (08-13-2018),Sonny1318 (08-13-2018),the_rotten1 (08-11-2018)

  3. #12
    Registered User C.Marie's Avatar
    Join Date
    05-14-2017
    Posts
    1,465
    Thanks
    4,683
    Thanked 703 Times in 603 Posts

    Re: Would you feed a ribbon snake to a king snake?

    Quote Originally Posted by PitOnTheProwl View Post
    Guess you don't want to know what I do with balls that need to be culled.......... I love my MBKs
    I think there is a world of difference between what you do verses going out to purchase a fully functional animal to feed off, I think it's wonderful you don't just throw the babe in the trash but instead make use of a life form that never got to be
    Domestic Short Hair - Miss Becky
    Russian Blue - Church
    Miniature Poodle - Pierre LaPoodlePants
    Banana BP - Yuri Katsuki

  4. The Following 7 Users Say Thank You to C.Marie For This Useful Post:

    Bogertophis (08-10-2018),BPGator (08-10-2018),Craiga 01453 (08-10-2018),jmcrook (08-10-2018),PitOnTheProwl (08-11-2018),Sonny1318 (08-13-2018),the_rotten1 (08-11-2018)

  5. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    A question for all the people that have made the argument of "snakes eat rodents in captivity so that is all you should feed them."

    Do you honestly feel that this is the best thing to do for species that have evolved to eat non-rodent? Especially with all of the very experienced breeders that are reporting high rates of things like obesity, fatty liver disease, metabolic failure, poor clutching, generally shorter life-spans, etc., in species like this when fed on exclusively rodent diets?

    If you really, truly believe in doing what is best for your animal then would it not be best to feed them what most closely resembles their evolved diet, be that something simple like supplementing with the occasional non-rodent item to something more complicated like going with an entirely non-rodent diet?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. The Following User Says Thank You to asplundii For This Useful Post:

    Bogertophis (08-13-2018)

  7. #14
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: Would you feed a ribbon snake to a king snake?

    Quote Originally Posted by asplundii View Post
    A question for all the people that have made the argument of "snakes eat rodents in captivity so that is all you should feed them."

    Do you honestly feel that this is the best thing to do for species that have evolved to eat non-rodent? Especially with all of the very experienced breeders that are reporting high rates of things like obesity, fatty liver disease, metabolic failure, poor clutching, generally shorter life-spans, etc., in species like this when fed on exclusively rodent diets?

    If you really, truly believe in doing what is best for your animal then would it not be best to feed them what most closely resembles their evolved diet, be that something simple like supplementing with the occasional non-rodent item to something more complicated like going with an entirely non-rodent diet?
    I do feed my retic a variety of prey items. She is not a picky eater for sure.

  8. #15
    bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,503
    Thanks
    2,891
    Thanked 9,862 Times in 4,780 Posts
    Images: 34

    Re: Would you feed a ribbon snake to a king snake?

    Quote Originally Posted by Skyrivers View Post
    I do feed my retic a variety of prey items. She is not a picky eater for sure.
    My retics, burm, anaconda, and boas also get a variety because I can get culled fowl, rabbits, and piglets locally from small farmers who otherwise produce them as organic and/or free-range human food. They are happy to have a source for their still/culls instead of having to just throw them on the muck heap.

  9. The Following 3 Users Say Thank You to bcr229 For This Useful Post:

    Bogertophis (08-13-2018),C.Marie (08-13-2018),Zincubus (08-13-2018)

  10. #16
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    6,952
    Thanks
    2,510
    Thanked 4,899 Times in 2,993 Posts

    Re: Would you feed a ribbon snake to a king snake?

    I know some who feed mice / rats / gerbils and all manner of birds .. it's not that uncommon


    Sent from my iPhone using Tapatalk




  11. The Following User Says Thank You to Zincubus For This Useful Post:

    C.Marie (08-17-2018)

  12. #17
    Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,249
    Thanks
    28,167
    Thanked 19,829 Times in 11,846 Posts
    I have fewer snakes now (only 16) but the years when I had many more & bred rats, mice, hamsters & gerbils, most of my snakes ate a variety. One day there
    was a pair of pigeons that put* a nest of babies right on the ground under a tree in my yard...there was no way my 4 dogs weren't going to find & destroy them,
    and I didn't think moving them was a great option, so yes, all the chicks were feeders, much to the dismay of the silly parent birds. I do agree that more variety
    is a good idea, especially leaner-type of prey, but some snakes are more apt to accept variety than others. BPs not so much, but rat snakes & pituophis (bull, pine, gopher snakes) and many others (kings, rattlesnakes, etc) are happy campers when you mix it up. BPs do tend to like hamsters & gerbils, but they can be
    stubborn about changing back & forth, so be careful what you try.

    (*the nest may have fallen out of the tree, but when I saw it, it didn't appear that way...so maybe they put it back together? Weird...and doomed.)
    Last edited by Bogertophis; 08-13-2018 at 02:23 PM.

  13. #18
    Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,249
    Thanks
    28,167
    Thanked 19,829 Times in 11,846 Posts

    Re: Would you feed a ribbon snake to a king snake?

    Quote Originally Posted by asplundii View Post
    A question for all the people that have made the argument of "snakes eat rodents in captivity so that is all you should feed them."

    Do you honestly feel that this is the best thing to do for species that have evolved to eat non-rodent? Especially with all of the very experienced breeders that are reporting high rates of things like obesity, fatty liver disease, metabolic failure, poor clutching, generally shorter life-spans, etc., in species like this when fed on exclusively rodent diets?

    If you really, truly believe in doing what is best for your animal then would it not be best to feed them what most closely resembles their evolved diet, be that something simple like supplementing with the occasional non-rodent item to something more complicated like going with an entirely non-rodent diet?
    That's a great point: I don't think it's just that we're feeding captive snakes the same thing either, but that they are DOMESTIC rodents, which have more fat than
    their wild counterparts because they eat "better" (or at least more grain, which fattens them up, not the variety of insects & plants they'd consume in the wild) and
    also because they have a "cushy" life.

    Part of the problem is with us, the keepers: we love these creatures & naturally want MORE, but that works against us doing the best practices. It's not just the rodents
    that sit around too much...so do the snakes. Their cages cannot begin to duplicate the activity they'd have in the wild. And then either we buy or breed domestic rodents
    to feed them, and they too are fairly inactive. Rodents love to run in wheels, but do you know any breeders that set up cages for them that allow that? I breed my own &
    I can answer that for you: no! There's a fairly good reason for that too...running in a wheel becomes sort of an addiction...and I've seen nursing mom-rodents try to get
    in a wheel with nursing babies tumbling off them...they are oblivious to the danger to their babies, so while they may "run themselves lean", it's very counter-productive.
    At least I do supplement my rodent's diet with things like kale, mealworms, bits of fruit/veggies & seeds for better nutrition...it's not just the commercial rodent chow.

    Snakes in the wild get a bit more natural sunlight too & while I cannot prove it, I'm willing to bet that's a positive influence on their immune system & metabolism. Like us!

    Eating varied wild prey also brings a wider variety of trace nutrients to snakes, and might even enhance their immune system because they'd have gradual exposure to
    more pathogens (in & on their prey) so that their bodies may then be better able to fight off infections...? Again, I'm speculating.

    So...anyone feel brave enough to surprise your BPs with new & exotic w/c prey?

  14. The Following User Says Thank You to Bogertophis For This Useful Post:

    C.Marie (08-13-2018)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1