» Site Navigation
3 members and 3,470 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,096
Threads: 248,539
Posts: 2,568,739
Top Poster: JLC (31,651)
|
-
Re: So what where mom and dad?
Originally Posted by JodanOrNoDan
The whitest combo is Lesser x Mojave.
Respectfully I disagree. The whitest combos I have seen are either all-white BlkELs or the all-white Pied combos. Every BluEL, even the whitest of them, develop a very light cream tone to them as they mature. Put a 1000g+ all-white BlkEL side by side with a white BluEL and you can see the difference (there is a YouTube video out there somewhere with a guy doing exactly this... Cannot recall who it was now though.)
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: So what where mom and dad?
Originally Posted by asplundii
Respectfully I disagree. The whitest combos I have seen are either all-white BlkELs or the all-white Pied combos. Every BluEL, even the whitest of them, develop a very light cream tone to them as they mature. Put a 1000g+ all-white BlkEL side by side with a white BluEL and you can see the difference (there is a YouTube video out there somewhere with a guy doing exactly this... Cannot recall who it was now though.)
Interesting! I'll have to look into that to see what you mean. I have heard that pied helps in whiteness, though since I already have lesser in my collection, I wanted to try for BluEL. I'm not super concerned about the snakes being whitest of whites, just as high white as I can get them. Def not going to be bummed as the cream shows up, though I have seen some flawless BluELs (maybe it's natural, ~maybe it's photoshop!~). But BlkEL is an interesting option. Super fire is a BlkEL, right? That would be a cool route if I got a mojave fire male.
Ball Pythons!
1.0 Normal - Echo
1.0 Spider Enchi Ghost - Whiskey
0.1 Super Pastel Lesser - Tango
1.0 Butter Spider Het Hypo - Foxtrot
Other Snakes!
0.1 Albino Paradox KSB - Socks
1.0 Jungle Carpet Python - JPEG
1.0 California Kingsnake - Salazar
Geckos!
0.2 Super Hypo Tangerine Leos - Riddle and Valkyrie
-
-
Re: So what where mom and dad?
Originally Posted by asplundii
Respectfully I disagree. The whitest combos I have seen are either all-white BlkELs or the all-white Pied combos. Every BluEL, even the whitest of them, develop a very light cream tone to them as they mature. Put a 1000g+ all-white BlkEL side by side with a white BluEL and you can see the difference (there is a YouTube video out there somewhere with a guy doing exactly this... Cannot recall who it was now though.)
LOL. You don't disagree. Whole comment was "The whitest combo is Lesser x Mojave. Outside of the BEL complex Ivories can be pretty white. So can white weddings."
Lesser x Mojave whitest BEL.
Honest, I only need one more ...
-
-
Re: So what where mom and dad?
Originally Posted by JodanOrNoDan
LOL. You don't disagree. Whole comment was "The whitest combo is Lesser x Mojave. Outside of the BEL complex Ivories can be pretty white. So can white weddings."
Lesser x Mojave whitest BEL.
Since I don't know, and am now curious, does a BlkEL not count as a BEL? If someone is using "BEL," is it to be assumed the eyes are blue? I know (or do I???) black eyed lucies and blue eyed lucies are different complexes, but I thought BEL was used interchangeably between the two.
I'm awful with morphs and trying to learn as much as I can. ;-;
Ball Pythons!
1.0 Normal - Echo
1.0 Spider Enchi Ghost - Whiskey
0.1 Super Pastel Lesser - Tango
1.0 Butter Spider Het Hypo - Foxtrot
Other Snakes!
0.1 Albino Paradox KSB - Socks
1.0 Jungle Carpet Python - JPEG
1.0 California Kingsnake - Salazar
Geckos!
0.2 Super Hypo Tangerine Leos - Riddle and Valkyrie
-
-
Re: So what where mom and dad?
Originally Posted by asplundii
Meh... I cheated LOL. I did PhantomPin x EnchiMojave in 2016 so I was pretty familiar with what I was looking at
PhantomPin is less disrupted/jagged in the pinstriping areas along the dorsal, minimal/no freckling in the dorsal, the laterals tend to be tighter together, the colour is about a half tone darker.
And I also have a hatchling PhantomPin sitting in a bin at home that looks spot on to yours
I agree about the dorsal, however all the phantom pins I have had do not have a dark line above the eye stripe. I have never had a jigsaw, however the ones I have seen all have a dark line above the eye stripe.
Honest, I only need one more ...
-
-
Re: So what where mom and dad?
Originally Posted by skydnay
Since I don't know, and am now curious, does a BlkEL not count as a BEL? If someone is using "BEL," is it to be assumed the eyes are blue? I know (or do I???) black eyed lucies and blue eyed lucies are different complexes, but I thought BEL was used interchangeably between the two.
I'm awful with morphs and trying to learn as much as I can. ;-;
The whole BEL abbreviation thing confuses people and we should probably stop using it. This is why some people will use BlkEL when talking about black eyed snakes, but this isn't right either because Black Eyed white snakes can be made from 2 different complexes which are not interchangeable (yellowbelly and fire). Different pied combos can also result in a mostly white snake.
When I say BEL I am referring to the complex containing mojaves, phantoms etc. Blue eyed supers and als. I think from now I on will refer to it as the mojave bel complex.
Last edited by JodanOrNoDan; 07-19-2018 at 01:50 PM.
Honest, I only need one more ...
-
-
Re: So what where mom and dad?
Originally Posted by JodanOrNoDan
The whole BEL abbreviation thing confuses people and we should probably stop using it. This is why some people will use BlkEL when talking about black eyed snakes, but this isn't right either because Black Eyed white snakes can be made from 2 different complexes which are not interchangeable (yellowbelly and fire). Different pied combos can also result in a mostly white snake.
When I say BEL I am referring to the complex containing mojaves, phantoms etc. Blue eyed supers and als. I think from now I on will refer to it as the mojave bel complex.
Oooooh, that makes a lot of sense. Thanks for clearing that up! I was unaware that YB can also produce white snakes. Geez, I'm sure once you're exposed to all this information, you have a good idea of what's going on, but for now, I'm having a hard time keeping track of just the popular morphs. @_@
Ball Pythons!
1.0 Normal - Echo
1.0 Spider Enchi Ghost - Whiskey
0.1 Super Pastel Lesser - Tango
1.0 Butter Spider Het Hypo - Foxtrot
Other Snakes!
0.1 Albino Paradox KSB - Socks
1.0 Jungle Carpet Python - JPEG
1.0 California Kingsnake - Salazar
Geckos!
0.2 Super Hypo Tangerine Leos - Riddle and Valkyrie
-
-
Re: So what where mom and dad?
Originally Posted by skydnay
Oooooh, that makes a lot of sense. Thanks for clearing that up! I was unaware that YB can also produce white snakes. Geez, I'm sure once you're exposed to all this information, you have a good idea of what's going on, but for now, I'm having a hard time keeping track of just the popular morphs. @_@
I have been obsessed with white BP's from the beginning. Especially the blue eyed ones, but I am working other combos including fire and yellowbelly. The only thing I have not started chasing is a white wedding.
My end goal are cherry bomb variations (REL, red eyed leucistic). White snake + albino.
Honest, I only need one more ...
-
The Following 2 Users Say Thank You to JodanOrNoDan For This Useful Post:
Craiga 01453 (07-19-2018),skydnay (07-19-2018)
-
3P's and REL's FTW!!!
great clutch. congrats!
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following User Says Thank You to Ax01 For This Useful Post:
JodanOrNoDan (07-19-2018)
-
Re: So what where mom and dad?
Originally Posted by JodanOrNoDan
I have been obsessed with white BP's from the beginning. Especially the blue eyed ones, but I am working other combos including fire and yellowbelly. The only thing I have not started chasing is a white wedding.
My end goal are cherry bomb variations (REL, red eyed leucistic). White snake + albino.
There's a couple places I have seen complaints about White Weddings, so I don't blame you on that one. I adore the blue eyes! It's so pretty, and really cool to see in a snake. Even the pastel's signature green eyes are gorgeous.
Holy moly, that would be something!! You gotta let me know if you can get some of those. I'd be curious to see what you can do with them!
Ball Pythons!
1.0 Normal - Echo
1.0 Spider Enchi Ghost - Whiskey
0.1 Super Pastel Lesser - Tango
1.0 Butter Spider Het Hypo - Foxtrot
Other Snakes!
0.1 Albino Paradox KSB - Socks
1.0 Jungle Carpet Python - JPEG
1.0 California Kingsnake - Salazar
Geckos!
0.2 Super Hypo Tangerine Leos - Riddle and Valkyrie
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|