» Site Navigation
1 members and 3,301 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,096
Threads: 248,539
Posts: 2,568,739
Top Poster: JLC (31,651)
|
-
So what where mom and dad?
This one should be easy guys...
Honest, I only need one more ...
-
The Following 5 Users Say Thank You to JodanOrNoDan For This Useful Post:
AbsoluteApril (07-20-2018),Ax01 (07-19-2018),Craiga 01453 (07-19-2018),DSeese (07-19-2018),Ronniex2 (07-20-2018)
-
Re: So what where mom and dad?
Quick guess.
Both parents have Mojave. At least one parent has the spider gene and pinstripe?
-
-
Registered User
Don't super Mojave leucies have a grey headstamp? Is that a mystic potion in there? Or purple passion?
**LU BALLZ** (IG. @lu_ballz)
-
The Following User Says Thank You to Sirus Uno For This Useful Post:
-
Re: So what where mom and dad?
Originally Posted by Sirus Uno
Don't super Mojave leucies have a grey headstamp? Is that a mystic potion in there? Or purple passion?
You could be right. The pinstripe spider one doesn't show the Mojave gene. I missed that at first glance. I suck at the morph guessing game. LOL.
Second guess is Mystic potion bread to a spider pin?
Last edited by Skyrivers; 07-19-2018 at 09:40 AM.
-
-
Hint. These are fresh out of the egg last night, this will cause color to be slightly off.
Honest, I only need one more ...
-
-
Re: So what where mom and dad?
Originally Posted by JodanOrNoDan
Hint. These are fresh out of the egg last night, this will cause color to be slightly off.
Am I close with the mystic potion X spider pin mojo?
-
-
PurplePassion x Jigsaw (or Passion Pin x Mojave)
Offspring pictured are a Passion, a PassionPin, two SuperMojave possible Pin, a Jigsaw, a PhantomPin, and a Phantom
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
JodanOrNoDan (07-19-2018)
-
Re: So what where mom and dad?
Originally Posted by Skyrivers
Am I close with the mystic potion X spider pin mojo?
You are close. Your eyes are playing tricks with you a bit. Daddy is my profile image.
Honest, I only need one more ...
-
-
Re: So what where mom and dad?
I have no idea, but I'm going to guess anyway!!!
Mystic Potion x Mojave Pinstripe
I don't necessarily see spider in there.
Edit: Uh oh, new info. Will have to make a new guess.
Last edited by skydnay; 07-19-2018 at 09:48 AM.
Ball Pythons!
1.0 Normal - Echo
1.0 Spider Enchi Ghost - Whiskey
0.1 Super Pastel Lesser - Tango
1.0 Butter Spider Het Hypo - Foxtrot
Other Snakes!
0.1 Albino Paradox KSB - Socks
1.0 Jungle Carpet Python - JPEG
1.0 California Kingsnake - Salazar
Geckos!
0.2 Super Hypo Tangerine Leos - Riddle and Valkyrie
-
The Following 2 Users Say Thank You to skydnay For This Useful Post:
JodanOrNoDan (07-19-2018),the_rotten1 (07-23-2018)
-
Re: So what where mom and dad?
Originally Posted by asplundii
PurplePassion x Jigsaw (or Passion Pin x Mojave)
Offspring pictured are a Passion, a PassionPin, two SuperMojave possible Pin, a Jigsaw, a PhantomPin, and a Phantom
Close enough. Got the Passion Pin. Good eye. A little hard to tell in this pick. Right now I am not thinking Phantom pin. I think they are both jigsaws. Any particular reason you say Phantom pin?
Honest, I only need one more ...
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|