Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,981

2 members and 2,979 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,102
Threads: 248,542
Posts: 2,568,765
Top Poster: JLC (31,651)
Welcome to our newest member, Geezy99
Page 2 of 2 FirstFirst 12
Results 11 to 16 of 16

Thread: Rhamphiophis

  1. #11
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,811 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6
    Love that head shape and those big eyes.
    Deborah Stewart


  2. The Following User Says Thank You to Stewart_Reptiles For This Useful Post:

    John1982 (07-06-2018)

  3. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Rhamphiophis

    Quote Originally Posted by John1982 View Post
    They were also listed as a pair but I'm not holding my breath.
    I have yet to find anyone that can accurately sex these short of actually catching a female in the act of laying eggs. There is one other way that might work but the jury is still out on that (I will hopefully have news on that in a bit).


    Quote Originally Posted by John1982 View Post
    If the locality info is accurate, then they'd have to be oxyrhynchus, eh?
    Rhamphiophis phylogeny is a bit of a mess... Could be oxyrhynchus, could be rostrata.


    Quote Originally Posted by John1982 View Post
    Regardless, I'm excited to be raising them up and working with a new(to me) genus.
    These guys are fun. Crazy smart, hyper-aware and fast as lightening. They are also an epic pain in the but to get pictures of in a light hood LOL

    One word of caution; They are rear-fanged venomous and the analysis of the venom would indicate that it is potentially pretty potent. I have heard some people try to play them off as being "mostly harmless, like hognose" but I feel that is a bit disingenuous, especially after watching how fast mice drop after being bitten. So I very strongly advocate handling with care.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    John1982 (07-09-2018),rottn (07-09-2018)

  5. #13
    BPnet Royalty John1982's Avatar
    Join Date
    08-13-2010
    Location
    Florida
    Posts
    4,009
    Thanks
    2,496
    Thanked 2,962 Times in 1,669 Posts

    Re: Rhamphiophis

    Quote Originally Posted by asplundii View Post
    I have yet to find anyone that can accurately sex these short of actually catching a female in the act of laying eggs. There is one other way that might work but the jury is still out on that (I will hopefully have news on that in a bit).
    Here are some neat visuals I found on sexing snakes with "delicate" penes. I'll definitely be doing some shed studies as I raise these critters.



    Quote Originally Posted by asplundii View Post
    Rhamphiophis phylogeny is a bit of a mess... Could be oxyrhynchus, could be rostrata.


    These guys are fun. Crazy smart, hyper-aware and fast as lightening. They are also an epic pain in the but to get pictures of in a light hood LOL

    One word of caution; They are rear-fanged venomous and the analysis of the venom would indicate that it is potentially pretty potent. I have heard some people try to play them off as being "mostly harmless, like hognose" but I feel that is a bit disingenuous, especially after watching how fast mice drop after being bitten. So I very strongly advocate handling with care.
    Thanks for the info, Asplundii.

  6. #14
    Registered User rottn's Avatar
    Join Date
    04-17-2018
    Posts
    46
    Thanks
    113
    Thanked 32 Times in 19 Posts
    Images: 5
    Super cute! And as already mentioned, a number of times, those EYES! Adorable!!! Are they nocturnal? Is that why they have such big eyes? Just curious.

  7. The Following User Says Thank You to rottn For This Useful Post:

    John1982 (07-09-2018)

  8. #15
    BPnet Royalty John1982's Avatar
    Join Date
    08-13-2010
    Location
    Florida
    Posts
    4,009
    Thanks
    2,496
    Thanked 2,962 Times in 1,669 Posts

    Re: Rhamphiophis

    Quote Originally Posted by rottn View Post
    Are they nocturnal? Is that why they have such big eyes? Just curious.
    Mine are up with the sun and cruising around, checking stuff out. I would guess they're just a more sight oriented species.

  9. The Following User Says Thank You to John1982 For This Useful Post:

    rottn (07-09-2018)

  10. #16
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Rhamphiophis

    Quote Originally Posted by John1982 View Post
    Thanks for the info, Asplundii.
    No worries. Nice to see other people working with them


    Quote Originally Posted by rottn View Post
    Are they nocturnal? Is that why they have such big eyes? Just curious.
    Quote Originally Posted by John1982 View Post
    I would guess they're just a more sight oriented species.
    John is correct, they are extremely sight-oriented. Like the N. American coachwhip they cruise around with their heads held up, constantly looking around. As soon as they notice I am in the snake room they come to the front of their tubs and watch everything I do. This trait is also how I get them to sit still in the light tent for pics. While I stand ready with the camera I have my kid put her hands on either side of the tent and twitch a finger every now and then. The snake will freeze for a moment and tongue to figure out what it saw moving and that is when I capture the shot. Works for them now while they are smaller but I have a feeling that when they are 1.5m long it will the trick will not be as effective
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Charis (07-10-2018),John1982 (07-10-2018)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1