» Site Navigation
4 members and 3,380 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,097
Threads: 248,539
Posts: 2,568,744
Top Poster: JLC (31,651)
|
-
BPnet Veteran
How will this morph age?
I recently purchased a orange dream x lemonback x super enchi. I am curious how this morph will generally age. I know each snake is different and a lot comes down to the breeder but was curious how these morphs normally age.
-
-
Re: How will this morph age?
No way for us to tell unless we see a picture
Sent from my SM-G950U using Tapatalk
1.0 Kenyan Sand Boa - Sir Hiss🎩🐍
0.1 Pastel Ball Python - Exzahrah
0.1 Brazilian Rainbow Boa - Nymeria
0.1 Suriname Red Tail BCC- Sascha
0.1 WT Ball Python- Ariana
1.0 Bumblebee Ball Python- Fabio
WISHLIST:
Dumerils Boa
Candino BP
Granite IJ Carpet Python
White Lipped Python
Komodo Dragon
"Normal is just a setting on the washing machine..."
-
-
OzzyBoids has an adult Enchi OD Pastel for sale right now on MorphMarket, while not identical, you can expect your animal to age somewhat similarly. I would suspect yours will retain a higher degree of yellow to it than Ozzy's animal and less of a tendency to brown down
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
-
The Following User Says Thank You to Jmarshall For This Useful Post:
-
Because of the lemon back it will only get better with age. A similar snake to compare it too would be A Fire OD Super Enchi .
This is just an Enchi Fire OD http://www.worldofballpythons.com/mo...-orange-dream/ as you can tell it matures well.
As to find adult pics of your particular morph it won't be easy many people only post hatchling pics
-
The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
-
Re: How will this morph age?
Originally Posted by Deborah
As to find adult pics of your particular morph it won't be easy many people only post hatchling pics
I always wondered why that was , I remember a while back I wanted to see what a banana clown looked like with some age on it but could not find one tell you posted one here.
Domestic Short Hair - Miss Becky
Russian Blue - Church
Miniature Poodle - Pierre LaPoodlePants
Banana BP - Yuri Katsuki
-
-
Re: How will this morph age?
Originally Posted by C.Marie
I always wondered why that was , I remember a while back I wanted to see what a banana clown looked like with some age on it but could not find one tell you posted one here.
Generally because most balls as adults are not all that good looking...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
C.Marie (05-31-2018),Lord Sorril (05-29-2018)
-
Registered User
Re: How will this morph age?
I think there is a certain charm to the way most age. Some however do undertake a huge transformation.
I'm always really shocked by how certain genes just lose all colour. But all genes seem to have that something that just makes them pop... recently I've read people saying that the pastel gene is totally unwanted especially in clowns. Yet I saw a video of a full on adult superfly leopard clown and wow...so crisp and bright.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|