» Site Navigation
1 members and 2,673 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,129
Threads: 248,574
Posts: 2,569,010
Top Poster: JLC (31,651)
|
-
Mites :(
So it turns out that Clark, our first BP that we got at Tinley in March, has mites. He shed a couple of days ago, and that's when we discovered them. I didn't think mites were going to be an issue for him since he's been eating great and hasn't soaked at all in his water dish.
I'm really hoping we caught them early, but here is how we've addressed them so far. I'd appreciate any feedback on whether we should do anything else or if I've missed something.
- Removed all substrate via vacuum from cages. Cleaned cages with diluted bleach solution and put down paper towels as cage liners.
- Soaked each snake in warm water with a little dish soap.
- Ordered Provent-a-Mite and Natural Chemistry Mite Spray (these arrived today).
- Soaked all cage items in hot water and bleach, rinsed thoroughly, air dried.
- Now that we have the mite sprays, we are following directions for treatment (ie, putting cages back together before using PAM). We'll treat everyone and all cages.
With the way our house is setup, it's not really feasible to quarantine in different rooms, and most of our snakes were acquired in a relatively short span of each other. (And admittedly I had no idea about quarantining snakes when we got Clark.)
Is there anything else I should be doing? We currently use ReptiBark for substrate - is this safe or should I use something else? I'm assuming Clark brought the mites in because we've seen no sign on other snakes so far, but I'm also irrationally paranoid that it might have been from his substrate.
Thank you!
-
-
Re: Mites :(
Also, we will obviously go to an exotic vet if we feel Clark or anyone else's condition is declining or if we can't get a handle on the mites ourselves.
-
-
Sorry for your bad luck! You should be keeping the snakes on white paper towels for some time to come, as mites tend to come back in generational waves. You need
to keep checking & re-checking.
If your Repti Bark was near any snakes that now have mites, you might want to bake it or toss it, out of an abundance of caution (in case some mites drifted into it).
When you soak your snakes in mild soapy water (like Ivory), use warmish water & stay with them for 20-30 minutes to make sure the mites drown. But, they can still
survive on the snake's face where you cannot soak, so keep in mind that while this helps, it's just part of the solution. It helps get rid of many mites quickly, but not all.
Make sure that NO bleach smell remains on any hides...& never use bleach on anything porous (like wood/branches) because the fumes are toxic & will not
come out. (actually, I think most people throw out any cage decor that's porous...it's asking for trouble, mites hiding in crevices?)
Happy to say I haven't ever had to use Provent A Mite so I'll let those members who have give you pointers on that, except to say that it's important to follow
the directions carefully, otherwise it can harm your snake.
Last edited by Bogertophis; 05-10-2018 at 11:31 PM.
-
The Following User Says Thank You to Bogertophis For This Useful Post:
-
Re: Mites :(
Originally Posted by Bogertophis
Sorry for your bad luck! You should be keeping the snakes on white paper towels for some time to come, as mites tend to come back in generational waves. You need
to keep checking & re-checking.
If your Repti Bark was near any snakes that now have mites, you might want to bake it or toss it, out of an abundance of caution (in case some mites drifted into it).
When you soak your snakes in mild soapy water (like Ivory), use warmish water & stay with them for 20-30 minutes to make sure the mites drown. But, they can still
survive on the snake's face where you cannot soak, so keep in mind that while this helps, it's just part of the solution. It helps get rid of many mites quickly, but not all.
Make sure that NO bleach smell remains on any hides...& never use bleach on anything porous (like wood/branches) because the fumes are toxic & will not
come out. (actually, I think most people throw out any cage decor that's porous...it's asking for trouble, mites hiding in crevices?)
Happy to say I haven't ever had to use Provent A Mite so I'll let those members who have give you pointers on that, except to say that it's important to follow
the directions carefully, otherwise it can harm your snake.
Thank you! We did toss anything wooden or porous, thankfully that was just a couple of items. I haven't noticed anything near Clark's eyes or pits, but definitely on the rest of his body.
My one question on the PAM is that it says to use with substrate, not on a bare bottom enclosure. So we added new substrate back into his cage before treatment, but I'd feel better treating the cages with paper towels as liners if that's safe to do with PAM?
-
-
You do not want to use a natural substrate when treating for mites, there are just too many places for them to hide, avoid the insecticide, and lay eggs. Use newspaper, spray the PAM on the newspaper, let it dry, and line the enclosures with it. Keep a supply of treated and dried paper on hand for when your snake makes a mess.
-
The Following 2 Users Say Thank You to bcr229 For This Useful Post:
Bogertophis (05-11-2018),WhompingWillow (05-11-2018)
-
I've had to deal with mites a few times, so far they weren't terribly hard to get rid of. My procedure is as follows...
Toss substrate and soak hides and other cage furniture in scalding hot soapy water for at least an hour, completely submerged. Do the same with the tank or tub and scrub the hell out of it.
Spray snake down with reptile relief spray and allow the snake to remain wet for at least 15min.
Set up clean cage with hide, water bowl, and paper towel substrate and add snake.
Treat snake and repeat cleaning for tank and furniture once a week for a month.
So far this has worked for me.
-
The Following User Says Thank You to Alter-Echo For This Useful Post:
-
Someone linked this video for me the last time I had a mite problem, and it's so simple to do. Re-apply the frontline to the snake after 2 weeks. Be sure to wait until the snake is completely dry before placing it back in the enclosure.
I also had PAM to spray all over nearby furniture and floors and outside the enclosures. I caught the mites really early, so I didn't find any dead bodies, but the mite issue was resolved doing both these.
-
The Following 3 Users Say Thank You to redshepherd For This Useful Post:
asplundii (05-11-2018),MissterDog (05-11-2018),WhompingWillow (05-11-2018)
-
Re: Mites :(
Originally Posted by redshepherd
Someone linked this video for me the last time I had a mite problem, and it's so simple to do.
You beat me to it Red
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Please forgive my skepticism, but how SAFE is Fipronil on snakes? They are very different, cold-blooded & typically much smaller than the dogs & cats for which
this product (Frontline spray for fleas & ticks on dogs & cats) was made. Just because an animal survives a treatment does not necessarily mean that it will not
become sick in 6 mos or a year with cancer or other related disease process...how long has this been used on snakes that have survived long-term? This is the
first time I've heard of anyone using Frontline spray on snakes.
-
-
Re: Mites :(
Thank you everyone! While I read about using Frontline spray in my research, I'll stick with the Natural Chemistry product and PAM for now.
I think what we'll do this weekend is take the substrate back out of Clark's cage and treat with PAM and paper towels. Fingers crossed!
-
The Following User Says Thank You to WhompingWillow For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|