Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 430

5 members and 425 guests
Most users ever online was 6,337, 01-24-2020 at 03:30 AM.


» Today's Birthdays

agape32 (38)
luckylukey (14)

» Stats

Members: 69,418
Threads: 243,840
Posts: 2,528,441
Top Poster: JLC (31,651)
Welcome to our newest member, JadeBoisvert61
Page 2 of 2 FirstFirst 12
Results 11 to 17 of 17

Thread: Albino Ultramel

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    877
    Thanks
    92
    Thanked 657 Times in 355 Posts
    I have to question the ID on this animal... I know that Candy Ultramel was made in the UK a few years back and it did not have any of the pattern disruption that animal has...

    Also... Why is this literal one-of-a-kind, double recessive animal priced lower than Dreamsicle or LASnows (both of which have been around for nearly a decade)?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #12
    BPnet Veteran cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,044 Times in 621 Posts
    Images: 16
    It's not what I expected either, much better than what I imagined. And the price is about 3x lower than it should be, a double recessive like this is a 10 year project, usually the first ones that come out sell for about $10,000.


  3. #13
    Registered User Amos1974's Avatar
    Join Date
    06-20-2010
    Location
    California, Bay Area
    Posts
    105
    Thanks
    17
    Thanked 61 Times in 34 Posts
    Images: 13

    Re: Albino Ultramel

    Quote Originally Posted by asplundii View Post
    I have to question the ID on this animal... I know that Candy Ultramel was made in the UK a few years back and it did not have any of the pattern disruption that animal has...

    Also... Why is this literal one-of-a-kind, double recessive animal priced lower than Dreamsicle or LASnows (both of which have been around for nearly a decade)?
    I agree and I don't expect the next albino ultramel to look like that... there is something else going on in that snake albino dose not chance the pattern like that...

  4. #14
    Registered User AnnieHeart's Avatar
    Join Date
    04-14-2018
    Location
    Ohio
    Posts
    516
    Thanks
    5
    Thanked 207 Times in 186 Posts
    What a beautiful snake! Congrats!!
    ~Annie
    ~

  5. #15
    Registered User ceh23's Avatar
    Join Date
    10-28-2013
    Location
    VA
    Posts
    183
    Thanks
    27
    Thanked 96 Times in 73 Posts
    Images: 4

    Re: Albino Ultramel

    Quote Originally Posted by AnnieHeart View Post
    What a beautiful snake! Congrats!!
    Very impressive.


    Sent from my iPhone using Tapatalk
    https://www.morphmarket.com/us/searc...t=&layout=grid

    Instagram - CH_Reptiles_com
    My BPs -

    https://youtu.be/TZB9IFIq6-g - Albino and Coral Glow Pastel
    https://www.youtube.com/watch?v=yM612TpsTkk&t=7s - Pastel Lesser Het Clown
    https://youtu.be/XubMkeMBkPU - Killer Blast
    https://youtu.be/OF-x6Lt-OgQ - Super Pastel Het Clown
    https://youtu.be/XhbnRoMn1Sk - Pastel Clown

  6. #16
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    877
    Thanks
    92
    Thanked 657 Times in 355 Posts

    Re: Albino Ultramel

    Quote Originally Posted by Amos1974 View Post
    I agree and I don't expect the next albino ultramel to look like that... there is something else going on in that snake albino dose not chance the pattern like that...
    Exactly! The Candy Ultramel had a perfectly normal pattern and since Albino and Candy are the same gene there is no reason Albino Ultramel should have a complete and total pattern disruption like that.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. #17
    Registered User
    Join Date
    09-06-2012
    Posts
    88
    Thanks
    2
    Thanked 21 Times in 14 Posts

    Re: Albino Ultramel

    Would a lavender albino look like like this with ultramel?

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1