Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,364

1 members and 3,363 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,097
Threads: 248,541
Posts: 2,568,756
Top Poster: JLC (31,651)
Welcome to our newest member, Travism91
Page 4 of 4 FirstFirst 1234
Results 31 to 31 of 31
  1. #31
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Reptilinks!!!???

    Quote Originally Posted by bcr229 View Post
    Live or f/t rats?
    F/T. I take the ASF juice and thaw it out enough to shake some into a snack-size Ziplock and then I place the single frozen feeder in there and drop it in the water bucket to thaw so that the scenting can permeate in.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    bcr229 (04-19-2018)

Page 4 of 4 FirstFirst 1234

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1