Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,083

1 members and 3,082 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,103
Threads: 248,542
Posts: 2,568,767
Top Poster: JLC (31,651)
Welcome to our newest member, Michaelmcalvey
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 21
  1. #11
    BPnet Veteran Aerries's Avatar
    Join Date
    02-16-2017
    Location
    Kissimmee Fl
    Posts
    951
    Thanks
    343
    Thanked 948 Times in 460 Posts
    Images: 16

    Re: Good ombination?

    I’m just waiting on Deb to pop up on here *chugs another beer and lights up a cig* hey pass the popcorn!


    Sent from my iPhone using Tapatalk

  2. The Following 4 Users Say Thank You to Aerries For This Useful Post:

    C.Marie (03-30-2018),Plasma (03-27-2018),purpleroan (03-27-2018),Scherf (03-27-2018)

  3. #12
    Registered User Scherf's Avatar
    Join Date
    03-19-2018
    Location
    Lex, KY
    Posts
    95
    Thanks
    20
    Thanked 23 Times in 16 Posts

    Re: Good ombination?

    Quote Originally Posted by AmericanTacos View Post
    I know how to write a (Blank)ing punnett square because I'm not an absolute idiot. Congratulations on taking 6th grade biology like everyone else, it really gives you the right the the condescending attitude.
    I would actually love to see you fill out a 5x6 punnet square (with percentages).... I watched my GF almost fail a genetics class (college) due to having to hand write 3x10 squares for cattle/pig breeding..... but you got this......
    Ball
    1.0 Enchi Lesser Killer Bee
    0.1 Killer King Clown
    0.1 Mystic Potion

    Retic
    1.0 Purple Phase Albino

  4. #13
    BPnet Veteran EDR's Avatar
    Join Date
    10-29-2015
    Location
    Chicago
    Posts
    642
    Thanks
    750
    Thanked 473 Times in 347 Posts
    Images: 43

    Re: Good ombination?

    Yeah welcome to the world of reptiles where everybody hates everyone for everything. And yes that's looks like really good pairing. I'd say go for it.
    0.1 : Albino Clown - GHI Pastave - Killer Bee Fader - Sugar Bee - Pastel het pied - Lemon Blast het puzzle

    1.0 : Banana - Mystic Potion 66% pos het pied - Pastel Lesser het puzzle - Super Pastel 66% pos het puzzle

    1.0 2012 Albino Red Tail

  5. The Following 2 Users Say Thank You to EDR For This Useful Post:

    AmericanTacos (03-30-2018),C.Marie (03-30-2018)

  6. #14
    BPnet Veteran Alter-Echo's Avatar
    Join Date
    03-13-2018
    Location
    Albion NY
    Posts
    839
    Thanks
    621
    Thanked 780 Times in 453 Posts
    Wow... ok then....

    To answer your question, the only issue I'd see with this pairing would be that super cinnamons can have kinked spines and facial deformities, and super butters can have eye deformities on occasion.

  7. The Following 2 Users Say Thank You to Alter-Echo For This Useful Post:

    AmericanTacos (03-30-2018),Ax01 (03-27-2018)

  8. #15
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: Good ombination?

    Quote Originally Posted by Alter-Echo View Post
    Wow... ok then....

    To answer your question, the only issue I'd see with this pairing would be that super cinnamons can have kinked spines and facial deformities, and super butters can have eye deformities on occasion.
    Isn't research wonderful!!!!!

    Careful OP might consider you an elitist breeder for knowing something.

  9. The Following User Says Thank You to Skyrivers For This Useful Post:

    Alter-Echo (03-27-2018)

  10. #16
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts

    Re: Good ombination?

    1. i am not a breeder but if i had a nickel for every time some new snakekeeper on this site ask the most basic husbandry or genetic questions, i could split it amongst everybody who it was directed to and we'd all be rich!

    2. don't say "If I didn't ask your opinion, I don't want it" in a public forum. if u want to pick and choose who to get opinions, feedback and advice from - u should PM them. but since u made a public thread, peeps are free to chime in and post whatever they want. like me, i want to post these pink tacos b/c your forum handle makes me laugh and it's Taco Tuesday:



    3.
    Quote Originally Posted by AmericanTacos View Post
    Your assumptions are terrible and pretentious, and if I wanted to kill myself I could just jump from your conclusions to the ground.
    Please call 1-800-273-8255 if u need help and/or need to talk to a profession. that's a strong statement to make.

    4.
    Quote Originally Posted by AmericanTacos View Post
    It was a simple question asking for the opinions of other breeders, and if you can't even answer the only thing originally asked - just don't give your opinion.
    Quote Originally Posted by Alter-Echo View Post
    To answer your question, the only issue I'd see with this pairing would be that super cinnamons can have kinked spines and facial deformities, and super butters can have eye deformities on occasion.
    ^ this. do u want to risk having deformed bb snakes? are u prepared to care for them or put them down?
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  11. The Following 3 Users Say Thank You to Ax01 For This Useful Post:

    Alter-Echo (03-27-2018),Craiga 01453 (03-27-2018),Plasma (03-27-2018)

  12. #17
    BPnet Veteran Alter-Echo's Avatar
    Join Date
    03-13-2018
    Location
    Albion NY
    Posts
    839
    Thanks
    621
    Thanked 780 Times in 453 Posts

    Re: Good ombination?

    Quote Originally Posted by Skyrivers View Post
    Isn't research wonderful!!!!!

    Careful OP might consider you an elitist breeder for knowing something.
    I'm an elitist breeder now? This means I need to start a YouTube channel and need to sell my snakes for twice the price of everyone else! Oh, and I'm gonna buy out reptichip, slap my face on it, and sell it for 40 bucks a brick! Look out world! Here comes echochips!

  13. The Following 2 Users Say Thank You to Alter-Echo For This Useful Post:

    C.Marie (03-30-2018),Craiga 01453 (03-27-2018)

  14. #18
    BPnet Veteran
    Join Date
    12-04-2017
    Location
    Durban, South Africa
    Posts
    297
    Thanks
    149
    Thanked 196 Times in 105 Posts
    @ AmericanTacos, what Calculator did you use, I would like to add it onto my list of Calculators I use.
    Ball Pythons
    1.0 Pinstripe
    1.0 Coral Glow Pastel
    1.0 Ginger Enchi
    1.0 Spectre
    1.0 BlackPastel Yellowbelly
    1.0 Albino
    1.0 Fire
    1.0 Enchi Mojave
    1.0 Enchi
    1.0 Calico
    1.0 Leopard
    0.1 Mojave Spider
    0.1 Butter
    0.2 Fire
    0.1 Yellow Belly
    0.2 Pastel
    0.3 Normal
    0.1 Bumblebee
    0.1 Mystic
    0.1 Enchi
    0.1 Pinstripe 66% het Pied
    0.1 Leopard

    Other Pythons
    1.0 Carpet Pythons

    BOAS
    1.1 Dumerils
    2.2 Red Tail


    Corns
    1.2 Amel

  15. #19
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Good ombination?

    To the OP:

    People have cautioned you as to the potential for kinking with SuperCinny but no one has mentioned that with SuperButter you have the potential for bug-eyes.

    Also something to consider, with SuperButter you will very likely end up in a position where you have no clue what other genes the animal may be carrying. Is the white snake you get from a clutch a SuperButter SuperCinny Enchi Pastel GStripe Hypo or is it just a SuperButter??? Do you want to hold it back to breed it out to find out? If you want to sell it then how do you market it?


    Quote Originally Posted by Reptilius View Post
    @ AmericanTacos, what Calculator did you use, I would like to add it onto my list of Calculators I use.
    That is the calculator from MorphMarket. My only caution with it is that it does not do well with a couple of the heteroallelic supers (BlkHead/Spider... Cinny/Huffman...) but it is a lot more friendly than most of the others
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  16. The Following User Says Thank You to asplundii For This Useful Post:

    AmericanTacos (03-30-2018)

  17. #20
    Registered User AmericanTacos's Avatar
    Join Date
    10-14-2017
    Posts
    48
    Thanks
    58
    Thanked 36 Times in 14 Posts
    cchardwick
    Thank you! I think they would be cool to breed as well - I made the simple mistake of asking whether there might be a better combo to pair her with but the more I think the more I'm set on this one. And I already know the breeder which makes me more comfortable with it

    Scherf
    Have fun with your popcorn but after this post I'm responding to any more stupid, petty comments. Not that your comments were stupid or petty but many on this little thread are. And yes, I did ask for opinions but what I got was the equivalent of this:
    Person 1: Hey I'm headed to the grocery store should I pick up some ice cream?
    Person 2: ACTUALLY you need to RESEARCH before you go around just purchasing food you know nothing about! You're not a REAL ice cream lover and you're not responsible enough to OWN ice cream yet... how about you actually THINK before you go out buying frozen goods when you probably don't even know how to MAKE ice cream.
    And I'm sorry your girlfriend can't fill out a Punnett square... but that's not my problem.


    Hannahshissyfix
    I was not lying in any post I made. This is the first snake that exclusively and solely belongs to me. I have always had shared responsibility of pet BP's before now. My parents had many snakes, and took great care of them, and I was raised knowing their way of caring for them. I was hyper-concerned about getting her in case the information I had grown up on was not correct, because I want to take absolutely perfect care of my animal. I personally don't think double checking my information is cause for scorn. Next time I will make SURE to head blindly into a commitment without ANY fact checking ^.^

    EDR
    Thank you! I'm trying very hard to find another place to connect with reptile lovers - I've found a very nice group on Instagram. I've stopped censoring myself on this website a bit because I don't particularly care whether I get banned. While there are some very nice people here, 90% of users seem to be exactly how I've described before... I just love the site's format.

    Alter-Echo
    Thanks for your info! I'll definitely research that and take it into consideration. I'm planning on talking to the breeders about the snake's lines and asking about any deformities in the past with their lineage.

    asplundii
    I'm not actually planning on selling any offspring. It's always been my dream to have a reptile room and be surrounded by snakes, and I figured breeding such a diverse combination would be better than buying snakes from many different breeders. And I mentioned to the person above i'm going to be contacting the original breeders to ask if there's been any problems like that with their lines. There's still the risk even if there hasn't been any problems, but I'll feel more comfortable if there haven't been.
    If I didn't ask your opinion, I don't want it.

    --

    Proud artist and reptile lover <3

    --

    Yes, I do believe snakes are capable of enjoying a human's presence.

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1