» Site Navigation
1 members and 2,964 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,122
Threads: 248,564
Posts: 2,568,914
Top Poster: JLC (31,651)
|
-
Registered User
-
-
Horrible at morphs fire pastel maybe, I am sure someone better will steer you right, congratulations what a cutie pie
Domestic Short Hair - Miss Becky
Russian Blue - Church
Miniature Poodle - Pierre LaPoodlePants
Banana BP - Yuri Katsuki
-
The Following User Says Thank You to C.Marie For This Useful Post:
-
Re: What morph?
Not good on morphs, but to me you sound confused about the type too. It's a Ball Python (Python regius).
Sent from my vivo 1601 using Tapatalk
-
The Following User Says Thank You to Tonald Drump For This Useful Post:
-
Re: What morph?
That’s a Ball Python and as for the morph I would say Pastel. Pastel gives it that yellow coloring and the yellow line patterning across the eyes is an indicator of pastel. If it’s eyes are green that’s an indicator of pastel as well
Just some friendly advice though, I would recommend ditching that log hide he is on for a hide that only has one opening. Those are not very secure and will him him feel exposed.
Hope this helps!
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to BluuWolf For This Useful Post:
-
Re: What morph?
Originally Posted by BluuWolf
Just some friendly advice though, I would recommend ditching that log hide he is on for a hide that only has one opening. Those are not very secure and will him him feel exposed.
Sent from my iPhone using Tapatalk
just cover the one end in substrate and good to go.
I'm not your friend buddy!
-
The Following User Says Thank You to djansen For This Useful Post:
-
Re: What morph?
Originally Posted by djansen
just cover the one end in substrate and good to go.
Yeah there was another thread I saw where they had kind of buried the back half and made it almost like a cave. It looked pretty cool too lol
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to BluuWolf For This Useful Post:
-
Definitely Pastel... Given some of the pattern disruption and the blushing I am half inclined to say Pastel Yellowbelly, but I would want belly pics to confirm.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Mind me asking what a speciment like that goes for at a place like that?
-
-
What morph?
Originally Posted by Phillydubs
Mind me asking what a speciment like that goes for at a place like that?
I’m not sure about PetSmart, but at Petco, “fancy” ball pythons are $149. The Spinner I got was in the fancy tank, along with a pinstripe. They also have a category called “rare,” which run $249. Ball pythons I’ve seen in those tanks include Banana, Albino and Genetic Stripe. They sell normals for $69, but I’ve always seen additional signage on the normal tank that says “normal ball pythons 50% off with Pals Rewards” If you’re in the Philly area,there are 2 stores with good selections. My full time gig is in Horsham, and the Willow Grove store is where I got my Spinner. I also work a 2nd job at a Harley dealer North of Philly, so I’ve checked out the Petco stores Feasterville and Bensalem also. They only have normals and said they don’t get much call for snakes. The best selection was the Petco on Roosevelt Blvd. One of the managers there said their GM breeds BP’s and loves snakes. The other night they had 2 Albinos, 2 Genetic Stripes, 1 Banana, 1 Pinstripe and she said they were getting more in on Wednesday, Feb 28th.
I hope that helps.
Sent from my iPhone using Tapatalk
Last edited by Sgt7212; 02-28-2018 at 02:35 AM.
Ball Pythons
0.1 Spinner -“Cuddle Bug”
0.1 Banana YB - “Chiquita Bonita”
0.1 Super Lesser BEL - “Daenerys - Mother of Dragons”
1.0 Pastel Highway - “Lt. Pete ‘Maverick’ Mitchell
1.0 Super Citrus Bearded Dragon hopefully shipping mid-March, name pending.
-
The Following User Says Thank You to Sgt7212 For This Useful Post:
-
Registered User
Re: What morph?
Originally Posted by BluuWolf
That’s a Ball Python and as for the morph I would say Pastel. Pastel gives it that yellow coloring and the yellow line patterning across the eyes is an indicator of pastel. If it’s eyes are green that’s an indicator of pastel as well
Just some friendly advice though, I would recommend ditching that log hide he is on for a hide that only has one opening. Those are not very secure and will him him feel exposed.
Hope this helps!
Sent from my iPhone using Tapatalk
Yes I have seen some people close the end of the log with substrate I will do that! Thanks.
Sent from my iPhone using Tapatalk
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|