Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 967

0 members and 967 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

SyHy4455 (58)

» Stats

Members: 75,122
Threads: 248,563
Posts: 2,568,909
Top Poster: JLC (31,651)
Welcome to our newest member, SyHy4455
Page 1 of 6 123456 LastLast
Results 1 to 10 of 54
  1. #1
    BPnet Veteran Aedryan Methyus's Avatar
    Join Date
    11-10-2016
    Location
    Pittsburgh, PA
    Posts
    933
    Thanks
    782
    Thanked 595 Times in 365 Posts
    Images: 7

    Angry Metcalf Reptiles Knowingly Shipped My SD Retics With Mites!!!

    So, yeah... I have had this $800.00 pair of 25% Kalatoa SD Retics paid for since clear back in November and have been anxiously waiting for a break in the weather, so they could be shipped. They were finally shipped out from Nebraska yesterday evening and will be on my doorstep in just a few short hours. I should be really happy and excited, shouldn't I? I'm not! I just woke up at 4:00 AM this morning to the following nonchalant message from Aaron Metcalf of Metcalf Reptiles:

    The albino gc has a couple mites before I shipped. I would let both snakes settle in for a day or two then soak them both in room temp water for 12-18 hrs. Only enough water to just cover their backs.
    Real cute, huh?

    My reply (with swear words omitted):

    Oh, that's just great dude! Are you kidding me right now!? Did you seriously just knowingly send me snakes with mites!? I am NOT happy! So, just let them "settle in for a day or two" and infest the rest of my animals with mites, huh? That's brilliant!
    I seriously should blow up this kid's cell phone right now at 5:00 AM and let him have it! It is beyond comprehension that there are breeders out there, who are conducting business like this kid, as well as a few others that I have encountered! There are other things about my experience with this breeder, too, which I won't get into right now. I'm sorry, but his honesty in letting me know that I have snakes on the way with mites included at no extra charge definitely does not outweigh the fact that he knowingly shipped these animals out to me with mites! The right thing to do would have been for him to contact me immediately the moment he noticed the mites and postponed shipping until HE made sure they were mite free! Am I right or am I right?

    So, anyway... Instead of continuing on with this rant, I need to do some quick thinking and preparation with very limited time and I am open to all of your suggestions! Unfortunately, I don't have a quarantine area setup and I really don't want to get into all of the reasons why I should and all of the reasons why that is way easier said than done. That being said, I have no choice other than to put these soon to be new arrivals in the same rack as my Boas and Ball Pythons when they get here, which is in the same room with my Blood and Short Tail rack. So, I have no choice other than to try and contain whatever mites these snakes may have to their slots in the rack. These guys should be on my doorstep within the next 4 - 5 hours and i'm not going to be able to make it to Petco before they arrive, because I have to be here for the delivery. I have read many times that Pam cooking spray is an effective way to prevent mites from spreading. Is that true? What if I ran to the store and got some Pam and wiped the whole top, bottom, side and rear of both of the slots they'll be in down real good, as well as the outside of their tubs? Should I wipe the inside of their tubs down with it, too? Then after they're delivered I could run to Petco and get mite spray to spray on them? I'm on the Petco website right now and the only reptile mite treatment they seem to carry is Natural Chemistry De Flea Reptile Relief, which can be sprayed directly on the animal and supposedly kills mites on contact. Have any of you ever used this product?

    https://www.petco.com/shop/en/petcos...-reptile-spray

    I really don't feel like spending $27.00 for a can of Provent A Mite if there is a cheaper way that is effective and unless there is a local pet store that carries it, it would take a few days to get here anyway if I ordered it online. I realize that mites are a common part of reptile keeping and it's not the end of the world, but i've never had to deal with them and I want to do everything possible to treat these new arrivals as quickly as possible and prevent them from spreading to my other animals. Please advise...

  2. #2
    BPnet Veteran Aedryan Methyus's Avatar
    Join Date
    11-10-2016
    Location
    Pittsburgh, PA
    Posts
    933
    Thanks
    782
    Thanked 595 Times in 365 Posts
    Images: 7
    This lady swears by treating mites with Pam cooking spray and claims that it kills them with only one treatment and it was recommended by her vet. She says to spray the snake down completely with Pam and let them sit for 20 minutes then wipe them down with baby shampoo in a warm bath...



    Based on this video and other things i've read, I feel like this should be effective, but will it also kill any eggs, which could be on the animals and prevent them from hatching?

  3. The Following User Says Thank You to Aedryan Methyus For This Useful Post:

    DLena (02-15-2018)

  4. #3
    BPnet Senior Member L.West's Avatar
    Join Date
    09-11-2008
    Location
    Deerfield, MI
    Posts
    1,941
    Thanks
    1,125
    Thanked 452 Times in 339 Posts
    Images: 5

    Re: Metcalf Reptiles Knowingly Shipped My SD Retics With Mites!!!

    Wow that does suck. I would be livid. I guess it's a good thing he alerted you to this.

    As you probably know, quantine is a must with any new additions. Besides mites, you want to avoid other illnesses coming in also.

    I would not put them in my existing rack. Go to a store and get tubs and cheap uth to set them up temporarily in another part of your house. An added expense but a lesson learned.

    Always keep pam on hand too.

    I'm sorry you have to deal with this but you definitely should have been prepared to qt.

    Best of luck to you.
    L. West
    1.0 CORAL ALBINO BOA (OWEN)
    1.0 PANAMANIAN HYPO BOA (SAWYER)
    1.0 DUMERIL'S BOA (GRAYSON)
    1.0 ALBINO HONDURAN (RIVER)
    0.1 TANGERINE HONDURAN (FAITH)
    1.0 ALBINO TESSERA CORN SNAKE (RILEY)

  5. The Following 2 Users Say Thank You to L.West For This Useful Post:

    Aedryan Methyus (02-15-2018),the_rotten1 (02-18-2018)

  6. #4
    BPnet Veteran Aedryan Methyus's Avatar
    Join Date
    11-10-2016
    Location
    Pittsburgh, PA
    Posts
    933
    Thanks
    782
    Thanked 595 Times in 365 Posts
    Images: 7
    Thanks, L. West. And, yes, I am most definitely livid! I just can't even fathom that someone would just go right ahead and ship animals out to someone KNOWING that they are sending them a box of mites! I will definitely be dealing with Aaron Metcalf later on and letting people know about his business practices!

    With regards to quarantine, 3/4 of the animals I currently have were purchased around the same time, so they would have all been sitting in quarantine together anyway. Aside from that, like I said, setting up a quarantine is way easier said than done unless you live in a warm, humid part of the world like Florida. Firstly, it is already costing me a fortune to control ambient room temperatures and humidity in one room of my house for my animals. My house is extremely dry in the winter, so I have to keep my heater vent closed in the snake room and run a space heater as well as a high output humidifier 24/7 all winter long. To do that in two rooms, it would probably run my electric bill up $300.00 - $400.00 a month. I love my animals to death and there isn't much I wouldn't do for them, but that just wouldn't be feasible or sensible in any way. Even if I set up a quarantine in another room and left the heater vents open, my thermostat in my house will never be set above 70 degrees, so how would I be able to keep the animal's cool side temperatures above 75 degrees? As far as humidity, i'm a firm believer of not using substrate for many reasons. I could use it for quarantined animals temporarily to help with humidity, but my house gets so dry in the winter that I think it would still be extremely challenging to keep humidity levels consistent. So, in a nutshell, I feel like unless people are able to properly heat, humidify and dedicate a whole second room to a quarantine, they are going to be running a very high risk of quarantined animals getting RIs and having digestive problems and everything else. So, it's sort of a catch 22 situation... All of the closets in my house are very shallow, so I wouldn't even be able to keep adequate size tubs in them. So, that isn't an option either. If anyone can think of a realistic way for me to setup a quarantine in this dry old house that isn't going to cause health problems to the animals or cost me another couple hundred dollars for another heater and humidifier (in addition to more thermostats) or run my electric bill up another couple hundred dollars per month I would definitely love to hear your ideas...

  7. The Following User Says Thank You to Aedryan Methyus For This Useful Post:

    L.West (02-15-2018)

  8. #5
    BPnet Veteran Phillydubs's Avatar
    Join Date
    02-04-2018
    Posts
    1,285
    Thanks
    510
    Thanked 1,244 Times in 667 Posts
    Wow I am very sorry. That is not cool at all!

    i can’t help on the mite front I just got my first snake but geez. What a message to send a customer.

  9. The Following User Says Thank You to Phillydubs For This Useful Post:

    Aedryan Methyus (02-15-2018)

  10. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    This vid from SBK might help you:

    https://www.youtube.com/watch?v=BwCAuhSVRV4

    I think you can pick up a bottle of the spray at TSC
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Aedryan Methyus (02-15-2018),C.Marie (02-15-2018)

  12. #7
    BPnet Senior Member CALM Pythons's Avatar
    Join Date
    12-31-2016
    Location
    None Ya
    Posts
    2,770
    Thanks
    3,090
    Thanked 2,442 Times in 1,365 Posts
    Images: 23

    Re: Metcalf Reptiles Knowingly Shipped My SD Retics With Mites!!!

    Im of no help except to sympathize with your anger.. I would not accept the snakes period, however that is just me. Im a freak about certain things like any kind of known Germ, Parasite etc.. That is a breeder i would Never do any kind of business with. I dont care how rare something he has is, how cheap or any other factor.
    If a breeder had a outbreak (it happens) and he told me I would possibly allow him to treat then send the snake a few weeks after making sure they are all set.
    Ive learned not to cause myself the anxiety Id have bringing a infected animal into my home with all my others quarantined or not. I would think about it 24/7 and I just cant have that.
    As far as your situation with not having a quarantine I won't comment on, I'm sure you already know how everyone will feel. That to me is the first clue I wasn't ready for another addition to the collection.
    Good Luck, hope whatever you decide works out for the best.


    Sent from my iPhone using Tapatalk
    Name: Christian
    0.1 Albino Ball (Sophie)
    0.1 Russo White Diamond (Grace)
    1.0 Hypo Burmese (Giacomo/AKA Jock)
    1.2 Razors Edge/Gotti & American Pit Bull
    ----------
    1.1 Albino/Normal Burmese (Mr & Mrs Snake)
    1.0 Albino Ball (Sully)

  13. The Following 2 Users Say Thank You to CALM Pythons For This Useful Post:

    Aedryan Methyus (02-15-2018),L.West (02-15-2018)

  14. #8
    BPnet Veteran Aedryan Methyus's Avatar
    Join Date
    11-10-2016
    Location
    Pittsburgh, PA
    Posts
    933
    Thanks
    782
    Thanked 595 Times in 365 Posts
    Images: 7
    Richard Allen from Reptile Rapture recommends a much easier and less messy way of treating snakes for mites. He recommends spraying the enclosure down with RID and letting it dry and wiping the animal down with Germ X hand sanitizer. I've purchased animals from Richard and i've talked to him (forever) on the phone a couple of times. He is a great guy and I trust him, so that's what i'm going to do. I already have Germ x hand sanitizer on hand, too, because that's what I use after handling my animals. So, i'm going to run and pick up some RID real quick to treat the tubs before they arrive and i'm also going to pick up some Pam just to wipe down the slots in the rack where these guys will be living to hopefully help prevent any mites from escaping. I don't know what more I can do at this point... What do you guys think?


  15. #9
    BPnet Senior Member CALM Pythons's Avatar
    Join Date
    12-31-2016
    Location
    None Ya
    Posts
    2,770
    Thanks
    3,090
    Thanked 2,442 Times in 1,365 Posts
    Images: 23

    Re: Metcalf Reptiles Knowingly Shipped My SD Retics With Mites!!!

    I wouldn't take in a snake with mites period like I said. They can get on your clothes and transfer.. The breeder should Never have sent it without discussing it with you first. I feel like the guy got his money and he doesn't care. I wouldn't except the snakes and id file a claim for the money back.


    Sent from my iPhone using Tapatalk
    Name: Christian
    0.1 Albino Ball (Sophie)
    0.1 Russo White Diamond (Grace)
    1.0 Hypo Burmese (Giacomo/AKA Jock)
    1.2 Razors Edge/Gotti & American Pit Bull
    ----------
    1.1 Albino/Normal Burmese (Mr & Mrs Snake)
    1.0 Albino Ball (Sully)

  16. The Following User Says Thank You to CALM Pythons For This Useful Post:

    Aedryan Methyus (02-15-2018)

  17. #10
    bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,507
    Thanks
    2,893
    Thanked 9,874 Times in 4,783 Posts
    Images: 34
    First, breathe. Any time you get a new snake you would be safe in assuming that it has mites until proven otherwise. I always treat my quarantine enclosures the day before the snakes show up.

    Second, treat the enclosures or tubs, rack, and paper substrate for the new snakes with the RID spray and ensure it's dry before putting the new snakes into their new homes.

    Third, use the RID similarly on the paper substrate and enclosures for your current snakes to help prevent them from getting infested. Do not spray it directly on the snakes and ensure the paper and tubs are dry before putting the snakes back.

    Fourth, get a bottle of the Frontline spray from SBK's video posted above and treat the snakes like he does when they come out of the shipping box. If you do this you shouldn't soak the snakes.

    Fifth, you have no business purchasing any more snakes until you can set up an effective quarantine area; mites are not the worst thing that can befall a keeper.

    Finally read my post #13 in https://ball-pythons.net/forums/show...elp-asap/page2
    Last edited by bcr229; 02-15-2018 at 09:43 AM.

  18. The Following 6 Users Say Thank You to bcr229 For This Useful Post:

    Aedryan Methyus (02-15-2018),CALM Pythons (02-15-2018),dadofsix (02-15-2018),GoingPostal (02-15-2018),L.West (02-15-2018),wolfy-hound (02-19-2018)

Page 1 of 6 123456 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1