Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,384

1 members and 3,383 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,096
Threads: 248,539
Posts: 2,568,733
Top Poster: JLC (31,651)
Welcome to our newest member, eamorris97
Results 1 to 2 of 2
  1. #1
    BPnet Senior Member cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,049 Times in 622 Posts
    Images: 16

    High Contrast X Low Contrast Albino?

    So if you bred a high contrast albino with a low contrast albino do you get half high contrast and half low contrast or do you get offspring that are medium contrast? The reason I ask is because I just picked up two adult albino females, one is high contrast the other low. Wondering if I should keep the lines separate or if I can mix them up.


  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    HC in Albinos is the result of selective breeding for the trait. Simply put, it is the result of other genes that impact the expression of contrast. No one has really looked at the inheritance pattern on these other genes but it is probably safe to say that at least some of them are likely to be inc-dom or dom in expression. That being the case, if you breed a HC to a LC then you will get a variety of expression from the offspring depending on how many of the HC-related genes each individual inherits but it is unlikely that any of the offspring will be as high in contrast as the original HC parent is (there are a couple exceptions to this but I am just going with the by-and-large likelihood.)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1