» Site Navigation
1 members and 3,281 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,096
Threads: 248,538
Posts: 2,568,732
Top Poster: JLC (31,651)
|
-
Re: King Snake in a Ball Python rack?
I'd be concerned about not giving the kings a decent / healthy temp gradient in a rack designed and set up for Royals ... I've never used a rack and have no experience with them though . The concern is still there though .
Sent from my iPad using Tapatalk Pro
-
-
Re: King Snake in a Ball Python rack?
Originally Posted by cchardwick
I keep 5 King snakes in the same rack as my ball pythons, ambient temp is 82F and hotspot is 90F. No problems at all. My king snakes never hang out on the hotspot. No problems feeding either.
That sounds like they may be staying in the cool side as it's the coolest place or most bearable place to be , though ... I may be completely wide of the mark here but I'm not certain that its offering them the chance to thermoregulate properly .....
Sent from my iPad using Tapatalk Pro
-
The Following User Says Thank You to Zincubus For This Useful Post:
Craiga 01453 (11-01-2017)
-
I would contend that it depends on a lot of variables that the OP has not provided before an accurate answer can be given; size of rack (6qt? 28qt? 41qt?), set points of rack, differential within the rack, etc...
I have a pair of GBKs. I was able to easily house them in the bottom tier of a 12 tall x 4 wide 41qt rack system. This did not provide any stress or challenge to the animals because: 1) I run my hot spot about 3 degrees lower than most ball keepers (30 versus 33), 2) the temps at the bottom of the rack tend to be lower than they do at the top of the rack, 3) the depth of the tub offers a wide degree of gradient, 4) I also run my ambient a bit lower than most.
All of that together makes it easy for me to house the GBKs in the same rack as the balls. Because I know the parameters and the tolerances of the animals.
Would I try to house an adult GBK in a 6qt baby ball rack running a hot spot of 33 with an ambient of 28? Not for one second!
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Craiga 01453 (11-01-2017),Zincubus (11-01-2017)
-
For my ball pythons in the rack I remove the substrate from the hotspot so they sit directly on the bottom of the tub right at 90F on the hotspot. I keep the substrate just on the cool side. For my king snakes I put substrate over the hotspot, an inch or two of Prococo coconut husk chips, so they don't sit directly on the heat. They do tend to burrow in the substrate but I'm not worried if they occasionally hit that 90F hotspot for a bit, it's been working fine for a couple years now. I also mist the coconut chips every couple days to keep it a little damp, never had shed issues with the Kings.
Last edited by cchardwick; 11-01-2017 at 10:12 AM.
-
The Following User Says Thank You to cchardwick For This Useful Post:
-
Registered User
Re: King Snake in a Ball Python rack?
Originally Posted by craigafrechette
Based solely on feeding response, I see no issue at all. Kings are garbage disposals and I have never run into feeding issues with any of my Kings.
Your original question was vague and people offered insight based on that.
I can see why the first person posted what they did which is why I replied with what I'm actually worried about, which was the feed response.
Originally Posted by craigafrechette
Then you came back with the temps aside thing saying your only concern was feeding response. Well, you absolutely SHOULD be concerned with temps
I came back with temps aside so it's clear that temperature is not what's concerning me (in other words, not a concern.) and so I don't get another reply the only addresses temps. Obviously I won't be keeping them in my freezer.
0.1 Super Lesser (Belle) |
1.0 Genetic Stripe BP (Toast)
|
1.0 Lavender Albino PH Snow |
0.2 DPH Albino Snow |
0.1 Normal (Edith) 3,200g |
0.1 Kingpin |
1.0 Lesser Silverstreak |
1.0 Champagne |
0.1 Black Pastel |
1.0 Lesser |
1.0 Mexican Black KS (Lopez) |
0.0.1 Crested Gecko |
-
-
Registered User
Re: King Snake in a Ball Python rack?
Originally Posted by asplundii
Would I try to house an adult GBK in a 6qt baby ball rack running a hot spot of 33 with an ambient of 28? Not for one second!
By my signature alone (see: 3,200g Normal), it's safe to say that I have racks that support at least up to 41qts if not more (unless I'm just a terrible snake owner, but I probably wouldn't be here asking for advice if that were the case). I have a custom rack that I built that supports everything from 6qts to 60qts so I can move my snakes along to other tubs as they get larger.
Originally Posted by asplundii
set points of rack, differential within the rack, etc... the temps at the bottom of the rack tend to be lower than they do at the top of the rack, 3) the depth of the tub offers a wide degree of gradient,
I mentioned in a previous comment that temps weren't going to be an issue. Since it keeps getting brought up, my BPs are kept on paper towels. I'll be keeping the king on substrate so not as much heat gets through. If I find that it's not enough, I'll use one of my bins that have an indent in the bottom so it doesn't get the full heat effect. Of course, I'll be testing the temps before I buy the snake.
Originally Posted by asplundii
I have a pair of GBKs. I was able to easily house them in the bottom tier of a...
Thanks. I just wanted to know if it could be done. I've heard stories of Kings smelling the Balls and going crazy.
Thanks to everyone for their input.
0.1 Super Lesser (Belle) |
1.0 Genetic Stripe BP (Toast)
|
1.0 Lavender Albino PH Snow |
0.2 DPH Albino Snow |
0.1 Normal (Edith) 3,200g |
0.1 Kingpin |
1.0 Lesser Silverstreak |
1.0 Champagne |
0.1 Black Pastel |
1.0 Lesser |
1.0 Mexican Black KS (Lopez) |
0.0.1 Crested Gecko |
-
-
Re: King Snake in a Ball Python rack?
Originally Posted by Monty44
I've heard stories of Kings smelling the Balls and going crazy.
A king snake will hit anything it thinks is food. One of mine nailed me because I'd picked steamed crabs earlier that day. It never occurred to me that he'd go for Chesapeake Bay blues & Old Bay.
-
-
Re: King Snake in a Ball Python rack?
Originally Posted by craigafrechette
Based solely on feeding response, I see no issue at all. Kings are garbage disposals and I have never run into feeding issues with any of my Kings.
However, I personally would NOT run my king temps that high. You've got some great people offering experience and knowledge about your temps because they genuinely care about the animals. Your original question was vague and people offered insight based on that. That's why temps came into play with their answers. Then you came back with the temps aside thing saying your only concern was feeding response. Well, you absolutely SHOULD be concerned with temps and I would NOT advise keeping Kings at those temps you mention. I have been keeping Kings for years and my temps never get higher than mid 80s.
Not to harp but to piggy back on craig's response in regards to temps. My colubrid's only see their temps go above 83F mark if the house ends up getting that hot during the REALLY warm days of summer in Ohio. Quite frankly if I have to deal with for a week or two then they do too because I'm not wasting money on air conditioning for the 2 or 3 weeks it might actually be uncomfortable. Doesn't harm the snakes and I just open the windows when it cools down at night and make sure water changes are daily instead of my every other day or so schedule.
I might get flak for saying this but there is evidence to suggest that 90F hotspots for a ball python aren't really that necessary and you could just bump that down to the 86-87 mark and find sort of a happy medium.
-
The Following User Says Thank You to Jhill001 For This Useful Post:
Craiga 01453 (11-03-2017)
-
Re: King Snake in a Ball Python rack?
Originally Posted by Jhill001
Not to harp but to piggy back on craig's response in regards to temps. My colubrid's only see their temps go above 83F mark if the house ends up getting that hot during the REALLY warm days of summer in Ohio. Quite frankly if I have to deal with for a week or two then they do too because I'm not wasting money on air conditioning for the 2 or 3 weeks it might actually be uncomfortable. Doesn't harm the snakes and I just open the windows when it cools down at night and make sure water changes are daily instead of my every other day or so schedule.
I might get flak for saying this but there is evidence to suggest that 90F hotspots for a ball python aren't really that necessary and you could just bump that down to the 86-87 mark and find sort of a happy medium.
Yep , I find my Kings and Corns really prefer the cooler temps tbh and only choose warmth after a feed ..
Sent from my iPhone using Tapatalk Pro
-
The Following User Says Thank You to Zincubus For This Useful Post:
Craiga 01453 (11-03-2017)
-
Re: King Snake in a Ball Python rack?
Originally Posted by Monty44
By my signature alone ... I mentioned in a previous comment that temps weren't going to be an issue... I just wanted to know if it could be done.
Mate... You asked a question in a very generalized manner and, after a number of experienced people had answered, seemed to blow off everything they said as if it were so much fluff.
I gave my reply out not just toward you but also toward everyone who had previously answered saying it could/should not be done to make the point that everyone was a little off base -- You for not giving specifics that people could properly use to help you answer and everyone else for assuming a single set way of doing things. I gave my exact conditions to illustrate how it could properly be done and I also gave an example of a situation that was blatantly unreasonable just to make the point of what would be bad. And instead of taking my answer as the help you specifically came here asking for, you instead took offense and bark back at me with snide comments... With all due respect, perhaps you ought to take the defensive tone down a notch or twelve.
Originally Posted by bcr229
A king snake will hit anything it thinks is food. One of mine nailed me because I'd picked steamed crabs earlier that day. It never occurred to me that he'd go for Chesapeake Bay blues & Old Bay.
I had that exact same thing happen to me. Got full on mauled by my GBK girl
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|