» Site Navigation
4 members and 3,411 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,096
Threads: 248,538
Posts: 2,568,730
Top Poster: JLC (31,651)
|
-
Re: Phantom?
Originally Posted by Ax01
i don't own an Albino/Lavender Albino Spider and don't know how they age. i do have a a few Spider combos tho. yes, they're white sides are indicators. also if you've noticed, they have whole individual belly/side wall scales that are yellow, gold, etc. speckled along the white sides. is this still true for Albino/Lavender Albino Spiders? it looks like the Phantom gene muddles this speckling from what i've seen. could be another indicator.
also did u see that Garrick Demeyer produced an Albino Super Phantom (or was it Albino Super Mystic)? it looked exactly how u would imagine it. really cool, not complete white. what other genes are at play in your REL project?
I have not seen the Albino Super Mystic, but I have see the Albino Mystic Potion. I would assume they are similar. With lavender I am expecting something pretty much the same but a little more purple with ruby eyes. I am attacking this problem from multiple angles. I produced a lot of het lavenders this year. I am keeping all the females. In addition to the animals on this thread, I have lavender hets that are lesser, mojave, mojave spiders, and phantom. The same goes with the boys. I only have one adult Phantom het lavender female though. With the boys, I am not sure who to keep. Breeding het to het only gives me a 1 in 16 of hitting a REL and a lot of maybe hets. In two years none of this is going to be a problem and I will be able to produce RELs on a regular basis, but I am old and impatient.
Honest, I only need one more ...
-
-
with those Lavenders and hets, u can make REL's w/ varying degree's of patterns or lack thereof.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following User Says Thank You to Ax01 For This Useful Post:
JodanOrNoDan (10-15-2017)
-
Ok, this has be stumped. After comparing a bunch of pictures as well as reading some info, it seems it can be difficult to determine Phantom in Albinos. But..I have seen a few pictures and also descriptions that talk about the "burned orange" coloration creeping up the sides.
Now, unless its a trick of the light, the last hatchling does seem to have a spattering of orangish all along its lower side, right next to the belly scales. Its best if you kind of lean back a bit and then look at the picture. Looking close, it seems to "disappear".
I warned you, I know nothing much about these genes, and this is a tough one.
I think it would help to put them all together on bright white paper and in bright light. It would show subtle difference in them. And some good "side shots" of them, as well..
Sorry I can't be of more help
Zina
0.1 Super Emperor Pinstripe Ball Python "Sunny" 0.1 Pastel Orange Dream Desert Ghost Ball Python "Luna" 0.1 Pastel Desert Ghost Ball Python "Arjanam" 0.1 Lemonblast Enchi Desert Ghost Ball Python "Aurora" 0.1 Pastel Enchi Desert Ghost Ball Python "Venus" 1.0 Pastel Butter Enchi Desert Ghost Ball Python "Sirius" 1.0 Crested Gecko ( Rhacodactylus ciliatus) "Smeagol"
"It is only with the heart that one can see rightly; what is essential is invisible to the eye." - Antoine de Saint-ExupÈry
-
The Following User Says Thank You to zina10 For This Useful Post:
JodanOrNoDan (10-15-2017)
-
I took what everyone said into consideration and had all these guys out together with their daddy yesterday. My best guess is this one. It has the least amount of white on the sides, strong burnt orange blushing and two tiny white spots. He is going to get held back. Thanks for everyone's input.
Honest, I only need one more ...
-
-
Re: Phantom?
Originally Posted by JodanOrNoDan
My best guess is this one... Thanks for everyone's input.
I realize you have made your decision but I still figured I would ante in. I am inclined to think that the first two animals in your original post are Phantom Spider. Phantom tends to broaden the black webbing on Spiders which you see in those two versus the last animal pictured
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
JodanOrNoDan (10-19-2017)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|