Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,415

4 members and 3,411 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,096
Threads: 248,538
Posts: 2,568,730
Top Poster: JLC (31,651)
Welcome to our newest member, eamorris97
Page 2 of 2 FirstFirst 12
Results 11 to 15 of 15

Thread: Phantom?

  1. #11
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Phantom?

    Quote Originally Posted by Ax01 View Post
    i don't own an Albino/Lavender Albino Spider and don't know how they age. i do have a a few Spider combos tho. yes, they're white sides are indicators. also if you've noticed, they have whole individual belly/side wall scales that are yellow, gold, etc. speckled along the white sides. is this still true for Albino/Lavender Albino Spiders? it looks like the Phantom gene muddles this speckling from what i've seen. could be another indicator.

    also did u see that Garrick Demeyer produced an Albino Super Phantom (or was it Albino Super Mystic)? it looked exactly how u would imagine it. really cool, not complete white. what other genes are at play in your REL project?
    I have not seen the Albino Super Mystic, but I have see the Albino Mystic Potion. I would assume they are similar. With lavender I am expecting something pretty much the same but a little more purple with ruby eyes. I am attacking this problem from multiple angles. I produced a lot of het lavenders this year. I am keeping all the females. In addition to the animals on this thread, I have lavender hets that are lesser, mojave, mojave spiders, and phantom. The same goes with the boys. I only have one adult Phantom het lavender female though. With the boys, I am not sure who to keep. Breeding het to het only gives me a 1 in 16 of hitting a REL and a lot of maybe hets. In two years none of this is going to be a problem and I will be able to produce RELs on a regular basis, but I am old and impatient.
    Honest, I only need one more ...

  2. #12
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts
    with those Lavenders and hets, u can make REL's w/ varying degree's of patterns or lack thereof.

    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  3. The Following User Says Thank You to Ax01 For This Useful Post:

    JodanOrNoDan (10-15-2017)

  4. #13
    BPnet Lifer zina10's Avatar
    Join Date
    08-09-2010
    Location
    southeast
    Posts
    4,573
    Thanks
    5,693
    Thanked 6,185 Times in 2,610 Posts
    Ok, this has be stumped. After comparing a bunch of pictures as well as reading some info, it seems it can be difficult to determine Phantom in Albinos. But..I have seen a few pictures and also descriptions that talk about the "burned orange" coloration creeping up the sides.

    Now, unless its a trick of the light, the last hatchling does seem to have a spattering of orangish all along its lower side, right next to the belly scales. Its best if you kind of lean back a bit and then look at the picture. Looking close, it seems to "disappear".

    I warned you, I know nothing much about these genes, and this is a tough one.

    I think it would help to put them all together on bright white paper and in bright light. It would show subtle difference in them. And some good "side shots" of them, as well..

    Sorry I can't be of more help
    Zina

    0.1 Super Emperor Pinstripe Ball Python "Sunny"
    0.1 Pastel Orange Dream Desert Ghost Ball Python "Luna"
    0.1 Pastel Desert Ghost Ball Python "Arjanam"
    0.1 Lemonblast Enchi Desert Ghost Ball Python "Aurora"
    0.1 Pastel Enchi Desert Ghost Ball Python "Venus"
    1.0 Pastel Butter Enchi Desert Ghost Ball Python "Sirius"
    1.0 Crested Gecko ( Rhacodactylus ciliatus) "Smeagol"

    "It is only with the heart that one can see rightly; what is essential is invisible to the eye."
    - Antoine de Saint-ExupÈry

  5. The Following User Says Thank You to zina10 For This Useful Post:

    JodanOrNoDan (10-15-2017)

  6. #14
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77
    I took what everyone said into consideration and had all these guys out together with their daddy yesterday. My best guess is this one. It has the least amount of white on the sides, strong burnt orange blushing and two tiny white spots. He is going to get held back. Thanks for everyone's input.

    Honest, I only need one more ...

  7. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Phantom?

    Quote Originally Posted by JodanOrNoDan View Post
    My best guess is this one... Thanks for everyone's input.
    I realize you have made your decision but I still figured I would ante in. I am inclined to think that the first two animals in your original post are Phantom Spider. Phantom tends to broaden the black webbing on Spiders which you see in those two versus the last animal pictured
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. The Following User Says Thank You to asplundii For This Useful Post:

    JodanOrNoDan (10-19-2017)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1