Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,450

0 members and 3,450 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,100
Threads: 248,542
Posts: 2,568,763
Top Poster: JLC (31,651)
Welcome to our newest member, Scott L.
Results 1 to 10 of 38

Threaded View

  1. #28
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I have yet to see a SuperRusso that did not develop a dorsal stripe. I will go one further and say I have witnessed the presence of a dorsal stripe in every super form of BluEL but the frequency and visibility of it is less likely with the strongest alleles in the group (e.g., Lesser, Butter, and possibly Bamboo) but the trade off is that the supers in the stronger alleles tend toward bug-eye
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Ax01 (01-12-2018),CALM Pythons (01-12-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1