» Site Navigation
3 members and 3,360 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,096
Threads: 248,538
Posts: 2,568,732
Top Poster: JLC (31,651)
|
-
Re: Lavender Albino or not?
Originally Posted by Albert Clark
This is one of the Candinos that I hatched out August 23, '17. Notice the darker ruby eye color.
Notice that the animal's entire head is in shadow which makes they eye appear darker than it actually is.
I have hatched Candino clutches the past three years, the eyes on Candinos as hatchlings are not noticeably different than the eyes of their Albino siblings. Further, as they mature, Candino eyes do not look like the one in the OP's picture.
Originally Posted by piedpiperballs
My best theory as to what morph the black eyed baby is as follows: The parents are by coincidence both het for Axanthic and the black eyed baby and one of the two normal babies to me display this gene
With all due respect, that is not how it works. Axanthic pulls yellow out while Lav drops the melanin. Neither of these conditions act to darken the eye. Hatchling LavSnows have red eyes the same as straight Lavs. As the animals age theirs eyes become a deeper claret-colour.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Lavender Albino or not?
Originally Posted by asplundii
Notice that the animal's entire head is in shadow which makes they eye appear darker than it actually is.
I have hatched Candino clutches the past three years, the eyes on Candinos as hatchlings are not noticeably different than the eyes of their Albino siblings. Further, as they mature, Candino eyes do not look like the one in the OP's picture.
With all due respect, that is not how it works. Axanthic pulls yellow out while Lav drops the melanin. Neither of these conditions act to darken the eye. Hatchling LavSnows have red eyes the same as straight Lavs. As the animals age theirs eyes become a deeper claret-colour.
Well that clearly is your position but we all can write our anecdotal findings when it comes to breeding and the visible differences in productions. While I respect your position I disagree with the statement on the way a particular hatchling may present based on a preconceived idea of breeding results over time. You can go on Morph market and view the multitude of hatchling Candinos and compare them to albinos and see in some of them ruby eye coloration is visible. Moreso in some than in others. Genetics is not a exact science and different outcomes and appearances can and do happen.
Last edited by Albert Clark; 09-25-2017 at 12:39 PM.
Stay in peace and not pieces.
-
-
Re: Lavender Albino or not?
Originally Posted by piedpiperballs
My best theory as to what morph the black eyed baby is as follows: The parents are by coincidence both het for Axanthic and the black eyed baby and one of the two normal babies to me display this gene. As for explaining the black eyes on the oddly colored lavender albino baby I have found photos of axanthic lavender albino balls with both black and red eyes. I'll post more photos as the baby matures. I have an adult female pied that surprisingly proved to be het for albino when I bred her with a male albino het for pied. I believe many of our ball pythons carry genes from previous generations being bred to recessive animals and babies were unknowingly het for these recessive traits and never proven out. Thanks for everyone's input on this puzzle.
what marker(s) do u see in the normal that indicates it may be het Axanthic? pix?
also i think i inadvertently planted the seed in your head to make u think it may be a Lavender Albino Snow when i drew comparison to the eyes of the Lavender Albino Snow in the other thread. i think your's has too many yellows to be a Snow. it should be more of a high white pattern with hints of yellow on a lavender background.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
-
Registered User
Re: Lavender Albino or not?
Originally Posted by Ax01
what marker(s) do u see in the normal that indicates it may be het Axanthic? pix?
also i think i inadvertently planted the seed in your head to make u think it may be a Lavender Albino Snow when i drew comparison to the eyes of the Lavender Albino Snow in the other thread. i think your's has too many yellows to be a Snow. it should be more of a high white pattern with hints of yellow on a lavender background.
Axanthic - While albinism is the lack of all melanin or pigment color, Axanthics only lack red or yellow or both. Axanthics are a recessive mutation that produces a snake that is varying shades of grey, black and brown.
I think that one of the normals babies looks to be Axanthic and the lavender albino baby as well. As for the dark eyes on the Lavender Albino see the definition above that states Axanthics can lack both yellow and red.
-
-
Re: Lavender Albino or not?
Originally Posted by piedpiperballs
Axanthic - While albinism is the lack of all melanin or pigment color, Axanthics only lack red or yellow or both. Axanthics are a recessive mutation that produces a snake that is varying shades of grey, black and brown.
I think that one of the normals babies looks to be Axanthic and the lavender albino baby as well. As for the dark eyes on the Lavender Albino see the definition above that states Axanthics can lack both yellow and red.
I need to note, red eyes on an albino are not the result of red pigment. They are the result of the melanin (and other pigments) in the eye being stripped away to review the capillaries beneath. The red color is derived from the animal's now-visible hemoglobin.
That said, I don't have an explanation for the weird, dark-eyed baby, except that it's a lavender albino with its color switched on early. Maybe due to poly genetic factors, maybe due to simple modifiers. Probably the only way to know is to hold the little guy back and breed it. It doesn't look like a lavender snow to me, though. The eyes of a lavender snow are bright ruby-scarlet, and the blotches are noticeably paler on a lav snow than your little guy. Am I saying it can't be? No, I can't. I just call it as it looks on my screen.
The almost greyish baby doesn't quite look axanthic, at least not on my monitor. What it reminds me of, is something that used to be seen from time to time with the old-school faded albinos. The hets would often hatch out looking very axanthic, then color up after a couple sheds. This was a visible marker for the faded trait. Maybe the separate gene(s) for fading got mixed into your lavs somewhere along the line, and the dark-eyed guy is a result?
Anyway. Two cents. Best,
-
The Following 3 Users Say Thank You to Alicia For This Useful Post:
Albert Clark (10-02-2017),piedpiperballs (09-27-2017),tttaylorrr (10-10-2017)
-
Re: Lavender Albino or not?
Originally Posted by piedpiperballs
Axanthic - While albinism is the lack of all melanin or pigment color, Axanthics only lack red or yellow or both. Axanthics are a recessive mutation that produces a snake that is varying shades of grey, black and brown.
I think that one of the normals babies looks to be Axanthic and the lavender albino baby as well. As for the dark eyes on the Lavender Albino see the definition above that states Axanthics can lack both yellow and red.
Axanthism is only a lack of yellow pigment, the lack of red pigment is anerythrism. Also, there is no red pigmentation in ball pythons, hence the reason Albino balls are only yellow and white
As Alicia noted, the red in Albino eyes is not derived from a pigment it is the result of the blood and the crystalline structure of the eye. This is why the Snow and LavSnow combos also have red eyes.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Lavender Albino or not?
I want to say candino as well but it's pattern and color looks off same with the eyes look way darker buy either way amazing
Sent from my SM-G920W8 using Tapatalk
-
-
Registered User
Re: Lavender Albino or not?
Originally Posted by Ballpythonguy92
I want to say candino as well but it's pattern and color looks off same with the eyes look way darker buy either way amazing
Sent from my SM-G920W8 using Tapatalk
Here is a photo after first shed.
Sent from my LG-D415 using Tapatalk
-
-
Re: Lavender Albino or not?
It looks like a banana to me lol but I'm far from an expert
Sent from my LG-D690 using Tapatalk
-
-
Re: Lavender Albino or not?
Originally Posted by piedpiperballs
Here is a photo after first shed.
Sent from my LG-D415 using Tapatalk
Originally Posted by BluuWolf
It looks like a banana to me lol but I'm far from an expert
well this has been an interesting couple of threads! is that a freckle? what if u had an Albino Banana/Coral Glow all along? this is just crazy. ballpythonguy92 is gonna flip.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|