» Site Navigation
1 members and 3,369 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,095
Threads: 248,538
Posts: 2,568,726
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
|
-
Registered User
Reputable red axanthic ball python/green back ball python breeders, continental US?
Looking for a het red or plain red, probably male, no other genes, anyone know someone who specializes in them? I'm willing to go It's a bit difficult to find.
I'm aware Corey Woods produces them, but he's in Canada and I don't want to deal with customs.
-
-
StillBP on this forum does a lot with red axanthic -- they're where I got Mazikeen!
0.1 Red Axanthic P. regius | Mazikeen
0.1 E. climacophora | Lan Fan
0.1 C. paulsoni | Inej
-
The Following 2 Users Say Thank You to Starscream For This Useful Post:
GoldSheep (09-21-2017),StillBP (09-21-2017)
-
J-Royals has had straight HRA in the past, not sure if he has any right now but it would be worth checking. He is a solid breeder.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Registered User
Re: Reputable red axanthic ball python/green back ball python breeders, continental U
I second Still Balls, he's who I get a lot of my snakes from outstanding guy. He's the one who actually turned me on to that gene! I got a single gene male for a great price, definitely hit him up!
1.0 Cinny-Pewter 0.1 Bumblebee het Albino 0.1 Cinnamon Queen Bee 0.1 Albino Spider 1.0 Mojave het OG 0.1 Mystic 1.0 GHI 1.0 Normal 0.1 Honey Het Red Axanthic
1.0 Platinum Reticulated Python
-
The Following User Says Thank You to Cass For This Useful Post:
-
Re: Reputable red axanthic ball python/green back ball python breeders, continental U
I have two adult female 1 HRA and 1 pastel HRA both came from Corry woods's stock and a few others from different people. And it is one of the main genes I work with. I however don't hatch very many single Gene animals. I have at least 4 (5 if my super red axanthic ghi female makes size) HRA combo pairings planned for this season.
If I can be of any help please let me know.
Laziness is nothing more than the habit of resting before you get tired.
-
The Following 2 Users Say Thank You to StillBP For This Useful Post:
GoldSheep (09-21-2017),Sunnieskys (09-21-2017)
-
HDI Reptiles, a breeder over here in the PacNW, is into HRA stuff. u can check out their FB page: https://www.facebook.com/reptilesnackshack (Reptile Snack Shack is the feeder side and storefront of the business) a very cool couple. i have a few of their BP's.
u can also see some of their animals in some of my reptile show pix thread here or here.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following User Says Thank You to Ax01 For This Useful Post:
-
Registered User
Re: Reputable red axanthic ball python/green back ball python breeders, continental U
Originally Posted by StillBP
I have two adult female 1 HRA and 1 pastel HRA both came from Corry woods's stock and a few others from different people. And it is one of the main genes I work with. I however don't hatch very many single Gene animals. I have at least 4 (5 if my super red axanthic ghi female makes size) HRA combo pairings planned for this season.
If I can be of any help please let me know.
Yeah, I would prefer a male, but if you have available females, I won't say no to that. I hatched a pewter and a bunch of cinnies, so you know I'm putting it back into the hobby. I've always wanted this morph when I first saw it due to the awesome blushing, etc.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|