» Site Navigation
3 members and 3,421 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,095
Threads: 248,538
Posts: 2,568,725
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
|
-
Question on spotnoses
Do all spot nose ball pythons have two spots on their nose/upper lip?
Do any other morphs have those spots?
Can they occur in a fire?
I'll have to get pictures of his face, but my fire het axanthic adult male has two spots on his upper lip like a spot nose would, but i dont work with spot nose and pictures online havent helped lol.
Sent from my SM-G920P using Tapatalk
-
-
The Spotnose morph is more than just about a spot on the nose, the mutation also alters the patterning of the whole animal.
And yes, spots on the nose can occur on other morphs, and also on WT
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Question on spotnoses
Originally Posted by asplundii
The Spotnose morph is more than just about a spot on the nose, the mutation also alters the patterning of the whole animal.
And yes, spots on the nose can occur on other morphs, and also on WT
Thanks! I forgot this thing had a search function, so I used it and read up more, he doesnt have the head stamp but I love his little snoot marks regardless
Sent from my SM-G920P using Tapatalk
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|