Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,177

2 members and 3,175 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,097
Threads: 248,539
Posts: 2,568,741
Top Poster: JLC (31,651)
Welcome to our newest member, Travism91
Results 1 to 2 of 2

Thread: Ivory+

Hybrid View

  1. #1
    Registered User smalltimeballz's Avatar
    Join Date
    05-20-2013
    Location
    South Texas
    Posts
    139
    Thanks
    21
    Thanked 37 Times in 29 Posts
    Images: 21

    Ivory+

    Hello guys and gals! I'm back to the BP world after too long of a hiatus. I've picked up this lovely girl and would like some suggestions. She was sold to me as Ivory pos super pastel, pastel, butter. I'm thinking she's either a super pastel or pastel butter, but I can't seem to find pics of super pastel butter ivorys either. The photos are from the breeder as my phone doesn't take the greatest pictures, but I am able to take more if requested. Also, I'm looking for pairing suggestions. I have about a year of research to do before it make sense to buy a male, but I have no idea which direction to go lol

    The pairing that produced her was Pastel Butter yb X Pastel yb

    Here she is:





    I think she's a great way to ease back into the hobby that I've missed so much.
    Ball Pythons:
    1.0 Hypo Clown; 1.0 Enchi Freeway; 0.1 Ivory pos. pastel, super pastel, butter (Penelope); 0.1 Hypo Chocolate GHI Pastel pos Vanilla (Smokey); 0.1 YB pied; 0.1 enchi YB/asphalt; 0.1 VPI Axanthic (Special Cookies); 0.1 Albino pos YB; 0.1 Hypo Clown; 0.1 Hypo Spinner
    Colubrids:
    1.0 Coachwhip; 1.0 Lavender ph hypo hoggie; 0.1 het hypo ph lavender hoggie (Fingermuncher)

  2. The Following User Says Thank You to smalltimeballz For This Useful Post:

    spellbound04 (08-17-2017)

  3. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    There is no Butter in that animal, I had an Ivory Butter Pastel and have an Ivory Butter OD Pastel, both are/were solid white. My guess is that it is a Ivory SuperPastel, that would account for the high yellow expression.


    As far as pairing suggestions... Kind of depends on your tastes. If you like bright combos then I would suggest something with OD and/or Fire and/or Enchi. If you are more of a dark-side type then I would suggest GHI. If you are more of a pattern person, BumbleBellies and their combos could be a way to go as would BellyBlasts
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following User Says Thank You to asplundii For This Useful Post:

    Ronniex2 (08-18-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1