Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,296

2 members and 3,294 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,095
Threads: 248,538
Posts: 2,568,728
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg

View Poll Results: What is your favorite albino?

Voters
107. You may not vote on this poll
  • Albino

    18 16.82%
  • Candy

    9 8.41%
  • Candino

    16 14.95%
  • Lavender

    52 48.60%
  • I don't like albinos

    12 11.21%
Page 2 of 6 FirstFirst 123456 LastLast
Results 11 to 20 of 53
  1. #11
    BPnet Veteran the_rotten1's Avatar
    Join Date
    07-22-2016
    Location
    Bakersfield, CA
    Posts
    613
    Thanks
    3,352
    Thanked 645 Times in 319 Posts
    Images: 11
    I didn't care much for albinos until I saw some of the high contrasts. When the colord bleeds together it's pretty unappealing, but as long as there's a clear distinction they can be really gorgeous. I love my high contrast girl. Cake is pretty awesome too.


    ~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~

    Check me out on iHerp, Instagram, & visit my store!


  2. The Following 6 Users Say Thank You to the_rotten1 For This Useful Post:

    Bogertophis (02-20-2019),C.Marie (03-06-2018),dakski (02-23-2018),Luvyna (02-09-2019),Sonny1318 (02-09-2019),Zincubus (06-22-2017)

  3. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: What is your favorite albino?

    I am an 'Ino fan because it allows me to go both directions is I am so inclined

    Quote Originally Posted by JodanOrNoDan View Post
    but I am after red eyed balls on this one.
    If the look of the eyes is important to you then one thing to note -- the eyes on 'Inos and pure Candy/Toffee are not bright red like the eyes of Albinos. On the prior they are a deeper garnet and on the latter they shift to an almost copper/bronze
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Albert Clark (05-20-2018),JodanOrNoDan (06-22-2017)

  5. #13
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: What is your favorite albino?

    Quote Originally Posted by asplundii View Post
    I am an 'Ino fan because it allows me to go both directions is I am so inclined



    If the look of the eyes is important to you then one thing to note -- the eyes on 'Inos and pure Candy/Toffee are not bright red like the eyes of Albinos. On the prior they are a deeper garnet and on the latter they shift to an almost copper/bronze
    Yeah. My lavenders have deep ruby red eyes, where the "normal" albinos are reddish pink. The candy I only know from pictures and babies I have seen. Hopefully I will be owning something in it with candy shortly if one of the board member's eggs ever hatch. lol. I really dislike the names candy and toffee. Very poor choices for a snake morph name in my opinion. Makes it sound like a kid's toy.

  6. The Following User Says Thank You to JodanOrNoDan For This Useful Post:

    Albert Clark (05-20-2018)

  7. #14
    Registered User Marzipan's Avatar
    Join Date
    12-26-2016
    Location
    UK
    Posts
    80
    Thanks
    371
    Thanked 35 Times in 25 Posts
    I don't know if this counts, but I really love the cinnamon albinos.

    Although it's difficult for me to choose, because albino has to be one of my favourite morphs.
    0.1 - Albino Spider 'Marzipan'



  8. The Following User Says Thank You to Marzipan For This Useful Post:

    C.Marie (03-06-2018)

  9. #15
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    6,952
    Thanks
    2,510
    Thanked 4,899 Times in 2,993 Posts

    What is your favorite albino?

    Quote Originally Posted by Marzipan View Post
    I don't know if this counts, but I really love the cinnamon albinos.

    Although it's difficult for me to choose, because albino has to be one of my favourite morphs.
    How about a Caramel Albino Spider Royal ?




    Sent from my iPad using Tapatalk
    Last edited by Zincubus; 06-22-2017 at 12:33 PM.




  10. The Following 4 Users Say Thank You to Zincubus For This Useful Post:

    C.Marie (03-06-2018),Luvyna (02-09-2019),Sonny1318 (02-09-2019),the_rotten1 (06-24-2017)

  11. #16
    Registered User
    Join Date
    05-04-2015
    Posts
    90
    Thanks
    0
    Thanked 42 Times in 29 Posts

    Re: What is your favorite albino?

    I'm a fan of Tucci here lol just because this grumpy lady is mine

    Sent from my LG-H831 using Tapatalk

  12. The Following 5 Users Say Thank You to monks98 For This Useful Post:

    C.Marie (03-06-2018),Luvyna (02-09-2019),Sonny1318 (02-09-2019),the_rotten1 (07-02-2017),Zincubus (06-23-2017)

  13. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: What is your favorite albino?

    Quote Originally Posted by JodanOrNoDan View Post
    I really dislike the names candy and toffee... Makes it sound like a kid's toy.
    With Toffee I at least understand the naming because the adults are, legitimately, toffee-coloured.


    Quote Originally Posted by JodanOrNoDan View Post
    Very poor choices for a snake morph name in my opinion.
    No worse than dozens of others out there LOL


    Quote Originally Posted by JodanOrNoDan View Post
    Hopefully I will be owning something in it with candy shortly if one of the board member's eggs ever hatch. lol.
    Well, if they do not end up with what you are looking for I might be able to help you out as well, depending on what hatches out of my AlbinoWoma x Candino clutch. If I hit the Woma'Ino then I will be making two breeder males carrying the Candy gene available
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  14. #18
    Registered User
    Join Date
    03-12-2015
    Posts
    136
    Thanks
    18
    Thanked 55 Times in 41 Posts
    Images: 1
    I like the Banana better than the albinos, but if I had to pick a true recessive albino, I would choose Lavender #1 Candy #2
    1.0 Banana Hypo
    1.0 Pastave Enchi
    1.0 Pastel +
    0.1 Normal Het. Hypo
    0.1 Killer Blast
    0.1 Killer Calibee
    0.1 Queenbee

  15. #19
    Registered User hollowlaughter's Avatar
    Join Date
    06-06-2017
    Location
    WI, USA
    Posts
    379
    Thanks
    131
    Thanked 245 Times in 174 Posts
    Images: 8
    Probably the Toffino for me.

  16. #20
    BPnet Lifer dakski's Avatar
    Join Date
    02-08-2014
    Location
    Connecticut
    Posts
    4,802
    Thanks
    8,109
    Thanked 9,691 Times in 3,863 Posts
    Images: 134

    Re: What is your favorite albino?

    I love Shayna, my Albino Spider. She has so much yellow and it glows! So bright and beautiful.

    When I saw her pictures as a baby, she had more white on her though, and I liked the contrast. By the time I got her at 200G, a lot had faded away and turned to yellow. Now, there is virtually no white banding (she's 5 1/2).

    Having said that, I am not disappointed. A) She's beautiful and is really a stunning animal. B) She is one of the best snakes I have ever had. She, seemingly, has more personality than some BP's, and likes to be out and exploring. She eats F/T happily, well, when she eats! She's about 1600G, so a really manageable size (this from the guy who is growing a female BCI!).

    People who are afraid of snakes often end up viewing her, or even holding her. She is so beautiful and not too big, and moves slowly and predictably. She has converted many people! Also, she has gotten many younger folks interested in reptiles.

    So, I like the contrast of traditional albinos, but being that Shayna totally rocks, I think Albino Spider's are my favorite!




  17. The Following 6 Users Say Thank You to dakski For This Useful Post:

    Bogertophis (02-20-2019),C.Marie (03-06-2018),c0r3yr0s3 (02-23-2018),Luvyna (02-09-2019),Maddlesrain (05-08-2018),Sonny1318 (02-09-2019)

Page 2 of 6 FirstFirst 123456 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1