» Site Navigation
1 members and 3,325 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,096
Threads: 248,539
Posts: 2,568,740
Top Poster: JLC (31,651)
|
View Poll Results: What is your favorite albino?
- Voters
- 107. You may not vote on this poll
-
Albino
-
Candy
-
Candino
-
Lavender
-
I don't like albinos
-
What is your favorite albino?
What is your favorite albino?
-
-
Registered User
Re: What is your favorite albino?
T negative blood python
-
The Following User Says Thank You to VIP CONSTRICTORS For This Useful Post:
JodanOrNoDan (06-21-2017)
-
Re: What is your favorite albino?
Originally Posted by VIP CONSTRICTORS
T negative blood python
LOL. Mine happens to be an Albino burm, but I am after red eyed balls on this one.
-
-
Re: What is your favorite albino?
I am an 'Ino fan because it allows me to go both directions is I am so inclined
Originally Posted by JodanOrNoDan
but I am after red eyed balls on this one.
If the look of the eyes is important to you then one thing to note -- the eyes on 'Inos and pure Candy/Toffee are not bright red like the eyes of Albinos. On the prior they are a deeper garnet and on the latter they shift to an almost copper/bronze
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Albert Clark (05-20-2018),JodanOrNoDan (06-22-2017)
-
Re: What is your favorite albino?
Originally Posted by asplundii
I am an 'Ino fan because it allows me to go both directions is I am so inclined
If the look of the eyes is important to you then one thing to note -- the eyes on 'Inos and pure Candy/Toffee are not bright red like the eyes of Albinos. On the prior they are a deeper garnet and on the latter they shift to an almost copper/bronze
Yeah. My lavenders have deep ruby red eyes, where the "normal" albinos are reddish pink. The candy I only know from pictures and babies I have seen. Hopefully I will be owning something in it with candy shortly if one of the board member's eggs ever hatch. lol. I really dislike the names candy and toffee. Very poor choices for a snake morph name in my opinion. Makes it sound like a kid's toy.
-
The Following User Says Thank You to JodanOrNoDan For This Useful Post:
Albert Clark (05-20-2018)
-
Re: What is your favorite albino?
Originally Posted by JodanOrNoDan
I really dislike the names candy and toffee... Makes it sound like a kid's toy.
With Toffee I at least understand the naming because the adults are, legitimately, toffee-coloured.
Originally Posted by JodanOrNoDan
Very poor choices for a snake morph name in my opinion.
No worse than dozens of others out there LOL
Originally Posted by JodanOrNoDan
Hopefully I will be owning something in it with candy shortly if one of the board member's eggs ever hatch. lol.
Well, if they do not end up with what you are looking for I might be able to help you out as well, depending on what hatches out of my AlbinoWoma x Candino clutch. If I hit the Woma'Ino then I will be making two breeder males carrying the Candy gene available
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
On their own I really don't care about Albino BP, I only care about two combos. (Albino Black Pastel & Albino Pied)
My main issue with albinos BP and most combos is the yellow bleeding into the white.
Now in other animals I am a big fan of High Orange or extreme Red Albino Hognose.
Last edited by Stewart_Reptiles; 06-21-2017 at 02:36 PM.
-
The Following 2 Users Say Thank You to Stewart_Reptiles For This Useful Post:
JodanOrNoDan (06-21-2017),nme0w (03-02-2018)
-
-
The Following 14 Users Say Thank You to Zincubus For This Useful Post:
- + Show/Hide list of the thanked
-
Albert Clark (05-20-2018),BeelzeBall. (06-21-2017),C.Marie (03-06-2018),cattleya0507 (03-30-2019),cletus (02-10-2019),lew-e (02-23-2020),Luvyna (02-09-2019),Maddlesrain (05-08-2018),Marzipan (06-22-2017),richardhind1972 (03-02-2018),RoyalLover (02-16-2019),silverdreams (06-22-2017),Sonny1318 (02-09-2019),Spechal (05-11-2018)
-
Registered User
Re: What is your favorite albino?
Originally Posted by Zincubus
Easy .
My Albino Imperial Peublan Hybrid ( Milk X King ) !!
Closely followed by Albino Royals , then Albino Retics
Sent from my iPad using Tapatalk
Holy mother of God that's beautiful...
-
The Following User Says Thank You to jonarnold85 For This Useful Post:
-
-
The Following User Says Thank You to BeelzeBall. For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|