» Site Navigation
1 members and 3,271 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,097
Threads: 248,539
Posts: 2,568,744
Top Poster: JLC (31,651)
|
View Poll Results: What is your favorite albino?
- Voters
- 107. You may not vote on this poll
-
Albino
-
Candy
-
Candino
-
Lavender
-
I don't like albinos
-
I didn't care much for albinos until I saw some of the high contrasts. When the colord bleeds together it's pretty unappealing, but as long as there's a clear distinction they can be really gorgeous. I love my high contrast girl. Cake is pretty awesome too.
~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~
Check me out on iHerp, Instagram, & visit my store!
-
The Following 6 Users Say Thank You to the_rotten1 For This Useful Post:
Bogertophis (02-20-2019),C.Marie (03-06-2018),dakski (02-23-2018),Luvyna (02-09-2019),Sonny1318 (02-09-2019),Zincubus (06-22-2017)
-
Re: What is your favorite albino?
I am an 'Ino fan because it allows me to go both directions is I am so inclined
Originally Posted by JodanOrNoDan
but I am after red eyed balls on this one.
If the look of the eyes is important to you then one thing to note -- the eyes on 'Inos and pure Candy/Toffee are not bright red like the eyes of Albinos. On the prior they are a deeper garnet and on the latter they shift to an almost copper/bronze
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Albert Clark (05-20-2018),JodanOrNoDan (06-22-2017)
-
Re: What is your favorite albino?
Originally Posted by asplundii
I am an 'Ino fan because it allows me to go both directions is I am so inclined
If the look of the eyes is important to you then one thing to note -- the eyes on 'Inos and pure Candy/Toffee are not bright red like the eyes of Albinos. On the prior they are a deeper garnet and on the latter they shift to an almost copper/bronze
Yeah. My lavenders have deep ruby red eyes, where the "normal" albinos are reddish pink. The candy I only know from pictures and babies I have seen. Hopefully I will be owning something in it with candy shortly if one of the board member's eggs ever hatch. lol. I really dislike the names candy and toffee. Very poor choices for a snake morph name in my opinion. Makes it sound like a kid's toy.
-
The Following User Says Thank You to JodanOrNoDan For This Useful Post:
Albert Clark (05-20-2018)
-
Registered User
I don't know if this counts, but I really love the cinnamon albinos.
Although it's difficult for me to choose, because albino has to be one of my favourite morphs.
0.1 - Albino Spider 'Marzipan'
-
The Following User Says Thank You to Marzipan For This Useful Post:
-
What is your favorite albino?
Originally Posted by Marzipan
I don't know if this counts, but I really love the cinnamon albinos.
Although it's difficult for me to choose, because albino has to be one of my favourite morphs.
How about a Caramel Albino Spider Royal ?
Sent from my iPad using Tapatalk
Last edited by Zincubus; 06-22-2017 at 12:33 PM.
-
The Following 4 Users Say Thank You to Zincubus For This Useful Post:
C.Marie (03-06-2018),Luvyna (02-09-2019),Sonny1318 (02-09-2019),the_rotten1 (06-24-2017)
-
Registered User
Re: What is your favorite albino?
I'm a fan of Tucci here lol just because this grumpy lady is mine
Sent from my LG-H831 using Tapatalk
-
The Following 5 Users Say Thank You to monks98 For This Useful Post:
C.Marie (03-06-2018),Luvyna (02-09-2019),Sonny1318 (02-09-2019),the_rotten1 (07-02-2017),Zincubus (06-23-2017)
-
Re: What is your favorite albino?
Originally Posted by JodanOrNoDan
I really dislike the names candy and toffee... Makes it sound like a kid's toy.
With Toffee I at least understand the naming because the adults are, legitimately, toffee-coloured.
Originally Posted by JodanOrNoDan
Very poor choices for a snake morph name in my opinion.
No worse than dozens of others out there LOL
Originally Posted by JodanOrNoDan
Hopefully I will be owning something in it with candy shortly if one of the board member's eggs ever hatch. lol.
Well, if they do not end up with what you are looking for I might be able to help you out as well, depending on what hatches out of my AlbinoWoma x Candino clutch. If I hit the Woma'Ino then I will be making two breeder males carrying the Candy gene available
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
I like the Banana better than the albinos, but if I had to pick a true recessive albino, I would choose Lavender #1 Candy #2
1.0 Banana Hypo
1.0 Pastave Enchi
1.0 Pastel +
0.1 Normal Het. Hypo
0.1 Killer Blast
0.1 Killer Calibee
0.1 Queenbee
-
-
Probably the Toffino for me.
-
-
Re: What is your favorite albino?
I love Shayna, my Albino Spider. She has so much yellow and it glows! So bright and beautiful.
When I saw her pictures as a baby, she had more white on her though, and I liked the contrast. By the time I got her at 200G, a lot had faded away and turned to yellow. Now, there is virtually no white banding (she's 5 1/2).
Having said that, I am not disappointed. A) She's beautiful and is really a stunning animal. B) She is one of the best snakes I have ever had. She, seemingly, has more personality than some BP's, and likes to be out and exploring. She eats F/T happily, well, when she eats! She's about 1600G, so a really manageable size (this from the guy who is growing a female BCI!).
People who are afraid of snakes often end up viewing her, or even holding her. She is so beautiful and not too big, and moves slowly and predictably. She has converted many people! Also, she has gotten many younger folks interested in reptiles.
So, I like the contrast of traditional albinos, but being that Shayna totally rocks, I think Albino Spider's are my favorite!
-
The Following 6 Users Say Thank You to dakski For This Useful Post:
Bogertophis (02-20-2019),C.Marie (03-06-2018),c0r3yr0s3 (02-23-2018),Luvyna (02-09-2019),Maddlesrain (05-08-2018),Sonny1318 (02-09-2019)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|