Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,337

3 members and 3,334 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,095
Threads: 248,538
Posts: 2,568,724
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
Page 2 of 2 FirstFirst 12
Results 11 to 18 of 18
  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Which male with Fire?

    Quote Originally Posted by JodanOrNoDan View Post
    I like the Disco stuff even though I don't care for pied too much. It is tempting.
    One thing to consider here with Disco, Vanilla, or any of the other alleles in the BlkEL group since you have expressed some concern about being able to ID Fire... I have heard many, many stories about people breeding out their Vanilla/Fire or Disco/Fire and not being able to tell which babies are which morph. It is enough of a detraction for me that I have chosen to only work with the Fire allele and save myself potential headaches
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #12
    Registered User ringorock's Avatar
    Join Date
    04-23-2017
    Location
    Woodstock, GA
    Posts
    122
    Thanks
    119
    Thanked 140 Times in 48 Posts
    No pastel in your collection? I have a mojave firefly, and the snake is just stunning.

  3. #13
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Which male with Fire?

    Quote Originally Posted by ringorock View Post
    No pastel in your collection? I have a mojave firefly, and the snake is just stunning.
    Oh yeah. I have pastel. 3 single gene, 1 pastel pin, 1 lemon blast, 1 killer bee, and 2 Pastel Pinstripe Phantoms. They are all girls though. LOL. I have not kept any male pastels. I am waiting to see which of the Pastel girls ages the best then I will use her to produce a Killer Bee male as a holdback. I am cautious with Pastel because I have seen too many age badly. I am lucky so far in that all but 2 of mine are above average so far. One of them all the yellow turned white. Another that I bought as a baby was exceptional but by the time she turned two her entire back browned out. I have one that is actually getting better with age which is really odd for a pastel. Her yellow seems to get better every year, but her genes don't seem to be "strong". So far the pastel in the babies she has produced is average.

    I am committed now. Enchi/Phantom/Pin locked with the Fire last night. Fingers crossed. Thanks everyone for helping me make up my mind.

  4. #14
    BPnet Veteran Devenco's Avatar
    Join Date
    05-17-2015
    Location
    The Netherlands
    Posts
    239
    Thanks
    104
    Thanked 113 Times in 85 Posts
    Images: 1

    Re: Which male with Fire?

    Quote Originally Posted by JodanOrNoDan View Post
    Oh yeah. I have pastel. 3 single gene, 1 pastel pin, 1 lemon blast, 1 killer bee, and 2 Pastel Pinstripe Phantoms. They are all girls though. LOL. I have not kept any male pastels. I am waiting to see which of the Pastel girls ages the best then I will use her to produce a Killer Bee male as a holdback. I am cautious with Pastel because I have seen too many age badly. I am lucky so far in that all but 2 of mine are above average so far. One of them all the yellow turned white. Another that I bought as a baby was exceptional but by the time she turned two her entire back browned out. I have one that is actually getting better with age which is really odd for a pastel. Her yellow seems to get better every year, but her genes don't seem to be "strong". So far the pastel in the babies she has produced is average.

    I am committed now. Enchi/Phantom/Pin locked with the Fire last night. Fingers crossed. Thanks everyone for helping me make up my mind.
    let's hope for a nice clutch

    was about to type go with enchi phantom pin, but read a bit further and saw you already did that

  5. The Following User Says Thank You to Devenco For This Useful Post:

    JodanOrNoDan (05-18-2017)

  6. #15
    Registered User ringorock's Avatar
    Join Date
    04-23-2017
    Location
    Woodstock, GA
    Posts
    122
    Thanks
    119
    Thanked 140 Times in 48 Posts

    Re: Which male with Fire?

    Quote Originally Posted by JodanOrNoDan View Post
    Oh yeah. I have pastel. 3 single gene, 1 pastel pin, 1 lemon blast, 1 killer bee, and 2 Pastel Pinstripe Phantoms. They are all girls though. LOL. I have not kept any male pastels. I am waiting to see which of the Pastel girls ages the best then I will use her to produce a Killer Bee male as a holdback. I am cautious with Pastel because I have seen too many age badly. I am lucky so far in that all but 2 of mine are above average so far. One of them all the yellow turned white. Another that I bought as a baby was exceptional but by the time she turned two her entire back browned out. I have one that is actually getting better with age which is really odd for a pastel. Her yellow seems to get better every year, but her genes don't seem to be "strong". So far the pastel in the babies she has produced is average.

    I am committed now. Enchi/Phantom/Pin locked with the Fire last night. Fingers crossed. Thanks everyone for helping me make up my mind.
    That makes it a Phire Pinch, right? You heard it here first, folks!
    Last edited by ringorock; 05-18-2017 at 11:43 AM.

  7. The Following User Says Thank You to ringorock For This Useful Post:

    JodanOrNoDan (05-18-2017)

  8. #16
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Which male with Fire?

    Quote Originally Posted by ringorock View Post
    That makes it a Phire Pinch, right? You heard it here first, folks!
    Maybe spelled with a y? Phyre Pinch

    You know, I didn't event think about it. It might be a first. If anyone has ever heard of a Enchi/Fire/Phantom/Pin being produced please let me know.

    This got me looking. There is a good chance that a Enchi/Pastel/Phantom/Pin will be laid in three weeks and a Super Enchi Phantom Pin will be laid this week.
    Will need a name for those as well.
    Last edited by JodanOrNoDan; 05-18-2017 at 12:04 PM.

  9. #17
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,811 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6
    I would go with this Enchi/Phantom/Pin or this Mojave/Phantom/Pin or even both.
    Deborah Stewart


  10. The Following User Says Thank You to Stewart_Reptiles For This Useful Post:

    JodanOrNoDan (05-18-2017)

  11. #18
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Which male with Fire?

    Quote Originally Posted by Deborah View Post
    I would go with this Enchi/Phantom/Pin or this Mojave/Phantom/Pin or even both.
    There's an idea. Dual sired clutch. The Fire Jigsaws are pretty hot.

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1