» Site Navigation
3 members and 3,334 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,095
Threads: 248,538
Posts: 2,568,724
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
|
-
Re: Which male with Fire?
Originally Posted by JodanOrNoDan
I like the Disco stuff even though I don't care for pied too much. It is tempting.
One thing to consider here with Disco, Vanilla, or any of the other alleles in the BlkEL group since you have expressed some concern about being able to ID Fire... I have heard many, many stories about people breeding out their Vanilla/Fire or Disco/Fire and not being able to tell which babies are which morph. It is enough of a detraction for me that I have chosen to only work with the Fire allele and save myself potential headaches
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
No pastel in your collection? I have a mojave firefly, and the snake is just stunning.
-
-
Re: Which male with Fire?
Originally Posted by ringorock
No pastel in your collection? I have a mojave firefly, and the snake is just stunning.
Oh yeah. I have pastel. 3 single gene, 1 pastel pin, 1 lemon blast, 1 killer bee, and 2 Pastel Pinstripe Phantoms. They are all girls though. LOL. I have not kept any male pastels. I am waiting to see which of the Pastel girls ages the best then I will use her to produce a Killer Bee male as a holdback. I am cautious with Pastel because I have seen too many age badly. I am lucky so far in that all but 2 of mine are above average so far. One of them all the yellow turned white. Another that I bought as a baby was exceptional but by the time she turned two her entire back browned out. I have one that is actually getting better with age which is really odd for a pastel. Her yellow seems to get better every year, but her genes don't seem to be "strong". So far the pastel in the babies she has produced is average.
I am committed now. Enchi/Phantom/Pin locked with the Fire last night. Fingers crossed. Thanks everyone for helping me make up my mind.
-
-
Re: Which male with Fire?
Originally Posted by JodanOrNoDan
Oh yeah. I have pastel. 3 single gene, 1 pastel pin, 1 lemon blast, 1 killer bee, and 2 Pastel Pinstripe Phantoms. They are all girls though. LOL. I have not kept any male pastels. I am waiting to see which of the Pastel girls ages the best then I will use her to produce a Killer Bee male as a holdback. I am cautious with Pastel because I have seen too many age badly. I am lucky so far in that all but 2 of mine are above average so far. One of them all the yellow turned white. Another that I bought as a baby was exceptional but by the time she turned two her entire back browned out. I have one that is actually getting better with age which is really odd for a pastel. Her yellow seems to get better every year, but her genes don't seem to be "strong". So far the pastel in the babies she has produced is average.
I am committed now. Enchi/Phantom/Pin locked with the Fire last night. Fingers crossed. Thanks everyone for helping me make up my mind.
let's hope for a nice clutch
was about to type go with enchi phantom pin, but read a bit further and saw you already did that
-
The Following User Says Thank You to Devenco For This Useful Post:
JodanOrNoDan (05-18-2017)
-
Re: Which male with Fire?
Originally Posted by JodanOrNoDan
Oh yeah. I have pastel. 3 single gene, 1 pastel pin, 1 lemon blast, 1 killer bee, and 2 Pastel Pinstripe Phantoms. They are all girls though. LOL. I have not kept any male pastels. I am waiting to see which of the Pastel girls ages the best then I will use her to produce a Killer Bee male as a holdback. I am cautious with Pastel because I have seen too many age badly. I am lucky so far in that all but 2 of mine are above average so far. One of them all the yellow turned white. Another that I bought as a baby was exceptional but by the time she turned two her entire back browned out. I have one that is actually getting better with age which is really odd for a pastel. Her yellow seems to get better every year, but her genes don't seem to be "strong". So far the pastel in the babies she has produced is average.
I am committed now. Enchi/Phantom/Pin locked with the Fire last night. Fingers crossed. Thanks everyone for helping me make up my mind.
That makes it a Phire Pinch, right? You heard it here first, folks!
Last edited by ringorock; 05-18-2017 at 11:43 AM.
-
The Following User Says Thank You to ringorock For This Useful Post:
JodanOrNoDan (05-18-2017)
-
Re: Which male with Fire?
Originally Posted by ringorock
That makes it a Phire Pinch, right? You heard it here first, folks!
Maybe spelled with a y? Phyre Pinch
You know, I didn't event think about it. It might be a first. If anyone has ever heard of a Enchi/Fire/Phantom/Pin being produced please let me know.
This got me looking. There is a good chance that a Enchi/Pastel/Phantom/Pin will be laid in three weeks and a Super Enchi Phantom Pin will be laid this week.
Will need a name for those as well.
Last edited by JodanOrNoDan; 05-18-2017 at 12:04 PM.
-
-
I would go with this Enchi/Phantom/Pin or this Mojave/Phantom/Pin or even both.
-
The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
JodanOrNoDan (05-18-2017)
-
Re: Which male with Fire?
Originally Posted by Deborah
I would go with this Enchi/Phantom/Pin or this Mojave/Phantom/Pin or even both.
There's an idea. Dual sired clutch. The Fire Jigsaws are pretty hot.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|