» Site Navigation
1 members and 3,436 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,096
Threads: 248,538
Posts: 2,568,732
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Making the cleanest black eyed leucistic
I was able to pick up a 0.1 Fire Spinner and am now in search of a 1.0 fire pinstripe as a mate. Has anyone been working with super fires crossed with pinstripes and/or spiders to reduce the spots for a cleaner white black eyed leucistic line?
I've seen one pic of a spider super fire that looked pretty clean. And I've seen the pinstripe latte BEL (super mocha) clean up the pattern of the latte BEL. And of course the white wedding (spied)...
Anyway, just curious if anyone has been tinkering with this.
-
The Following User Says Thank You to bait4snake For This Useful Post:
-
I haven't yet, but I have my 0.1 Fire and once I get my racks in a couple months I'll be searching for a mate as well and starting my breeding project with them in a couple years. I hope you get an answer from someone that has played around with this, I could use the info as well ^_^
1.0 Normal (Emrys)
0.1 Fire (Calypso)
0.1 Pied (Tessa)
0.1 Albino Kingsnake (Nienna)
2.1 Cats (Suki, Daisuke, and Kyo)
0.0.2 Leopard Geckos (Chi and Pixel)
-
-
Given the tendency for Pin to act as a pattern retainer I would be inclined to think that a SuperFire Pin will display high orange
Flip side, the Spider tendency to imbalance pigment could help promote a high white super
From what I have seen, Pastel seems to result in higher white supers. And I suspect that Cinny/BlkPastel will make higher white supers. Additoinally, this past season I hatched out 1.1 BlkELs from FireFly x BellyFly, one is pure white and the other has a singe, lentil-sized pale yellow patch. Without breeding them out I cannot say what genes each is carrying but it is possible that one or both have YB so it is possible that YB will also act to promote high-white BlkELs
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
JodanOrNoDan (04-07-2017)
-
It would definitely be interesting to see what pin does to the super fire. Pastel definitely consistently makes cleaner higher white black eyed lucy's, but that's all I know for sure. I don't think anyone has suggested lesser/butter but I would imagine it would increase white as well.
-
The Following User Says Thank You to Trisnake For This Useful Post:
-
BPnet Veteran
Hmm... maybe a male firefly or superfly is in order 😎
-
-
http://www.morphmarket.com/us/c/rept...-pythons/45704
Found a couple great Fireflys on Morph Market. Wish I had the money right now to snatch one up, hopefully I can find one like it in a month or two.
1.0 Normal (Emrys)
0.1 Fire (Calypso)
0.1 Pied (Tessa)
0.1 Albino Kingsnake (Nienna)
2.1 Cats (Suki, Daisuke, and Kyo)
0.0.2 Leopard Geckos (Chi and Pixel)
-
-
BPnet Veteran
Yeah, I'll be checking them out.
Right now I have a 1.0 Pastel Lesser and 0.1 Pastel Butter, hopefully I'll get some bright white BEL out of those. I also have a 0.1 Mojave Spider for him too. I'm excited to see what kinds of white snakes I'll be getting.
-
-
Re: Making the cleanest black eyed leucistic
Originally Posted by bait4snake
Yeah, I'll be checking them out.
Right now I have a 1.0 Pastel Lesser and 0.1 Pastel Butter, hopefully I'll get some bright white BEL out of those.
The only problem I see here is not knowing what is what in the outcome. I mean if you get a BEL then you know it is Butter and Lesser but if you get anything else you might have problems at the time of sale. Some people don't care but others will want to know for sure if its a Butter or Lesser gene.
-
The Following User Says Thank You to PitOnTheProwl For This Useful Post:
JodanOrNoDan (04-07-2017)
-
BPnet Veteran
Not sure if the same could work with a super fire, but here's a super mocha bel with pinstripe.
http://www.morphmarket.com/us/c/rept...-pythons/27815
-
-
Re: Making the cleanest black eyed leucistic
Nice pick ups I'm currently going to pick up a female het Russo on Sunday from Henry p
retro gaming pokemon for gbc/gba p.s. I've never played go nor shall i !!!!!
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|