» Site Navigation
1 members and 3,215 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,136
Threads: 248,575
Posts: 2,569,031
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Re: Think I'm in the process of getting ripped off...
Originally Posted by MrLang
Says he's in the process of opening a business...
gets scared at the idea that laws have been broken...
mom calls.
You got duped by a teenager bro
Actually, I've talked to people that've done face to face business with the guy and apparently he's in his mid to late 20's.
-
-
Think I'm in the process of getting ripped off...
My 5y/o is a better businesswoman. She sells the girl scout cookies and delivers!
This guy is a joke.
1.0 normal bp
mad roaches yo
-
The Following User Says Thank You to Mike41793 For This Useful Post:
-
Re: Think I'm in the process of getting ripped off...
Originally Posted by ChaosAffect
Actually, I've talked to people that've done face to face business with the guy and apparently he's in his mid to late 20's.
Sorry my joke was in bad taste. I really hope this gets resolved for you. I would definitely post on the BOI that his mom called you. Even if this gets resolved, I'm pretty sure nobody wants to do business with someone that has their mommy call to defend them after they're clearly in the wrong.
: /
-
-
BPnet Veteran
Re: Think I'm in the process of getting ripped off...
Originally Posted by MrLang
Sorry my joke was in bad taste. I really hope this gets resolved for you. I would definitely post on the BOI that his mom called you. Even if this gets resolved, I'm pretty sure nobody wants to do business with someone that has their mommy call to defend them after they're clearly in the wrong.
: /
No worries, man. If I saw that someone's mom started talking for them (She sent me an email, BTW. No call.) then I would assume they were a kid too. For a grown man, though... Of course, from the research I've done it's not really surprising. I was trying to verify the address he gave me and came across a court filing where his mom got custody of his kid.
-
-
BPnet Veteran
Well, we've got another development. Just got a call from him. He claimed that he lost his phone for a week and doesn't have internet access other than his phone, but he's going to print the shipping label through SYR in the next couple of minutes and send me the tracking. On top of that he said that he'll be shipping me a clutchmate of the original Fire het Albino, another female Fire het Albino, plus a bunch of extra goodies. I'm really in an "I'll believe it when I see it" place, but if he does follow up then it'll go a long way to making up for the past week of uncertainty.
-
-
BPnet Veteran
Good to hear that he is at least communicating with you.
And I agree with the "I'll believe it when I see it mentality".
Good luck
0.1 Butter
0.2 Pastel
0.1 Cinnamon
0.1 Bumblebee
0.1 Cinnamon Mystic
0.4 Black Pewter
0.1 Lemonblast
0.1 Black Pastel Pinstripe
1.0 Super Pastel
1.0 Coral Glow
1.0 Coral Glow Mojave
Coming soon:
1.0 Super Emperor
-
-
On top of that he said that he'll be shipping me a clutchmate of the original Fire het Albino, another female Fire het Albino, plus a bunch of extra goodies.
yeah, when pigs fly
Jerry Robertson
-
-
Re: Think I'm in the process of getting ripped off...
Originally Posted by ChaosAffect
He claimed that he lost his phone for a week and doesn't have internet access other than his phone, but he's going to print the shipping label through SYR in the next couple of minutes and send me the tracking.
Two things about this make me cringe
1) If he only has internet access on his phone then how is he going to print a FedEx label? Or can phones print these days??
2) I am not sure FedEx does Friday overnight with guaranteed delivery on Saturday and I know that no self-respecting herp shipper would ship on a Friday
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Think I'm in the process of getting ripped off...
Originally Posted by asplundii
Two things about this make me cringe
1) If he only has internet access on his phone then how is he going to print a FedEx label? Or can phones print these days??
2) I am not sure FedEx does Friday overnight with guaranteed delivery on Saturday and I know that no self-respecting herp shipper would ship on a Friday
1) He's at his mom's house.
2) It's not going out until Monday.
I have gotten a tracking number now, though. Things are looking up.
Oh, and phones can print. I've got a cheapo HP deskjet that has software that actually lets me print to it from pretty much anywhere on my phone. It's awesome.
Last edited by ChaosAffect; 05-17-2013 at 12:30 PM.
-
-
Glad to hear that things are improving. Things happen to the best of us, but all's well that ends well. Keep us updated on what you end up getting.
1.1 Ball Pythons
a) Calliope 0.1, Banana Ball, 2018/19 season, 600g
b) Geralt 1.0 Chocolate Sable Mojave pos. Trick ball, May 27th 2020
3.2 Cats (Fury, Leviathan, Walter, Chell, Amelie); 2.0 Dogs (Bjorn, Anubis); 2.1 Ferrets (Bran, Tormund, Arya); 0.1 Beardie (Nefertiti); 0.1 Slider Turtle (Species uncertain) (Papaya); 2.0 Hermit Crabs (Tamatoa, Sushi); 0.1 Conure (Mauii); Two Axolotyls (Quetzl and Unnamed); Two Tree Frogs (Pluto and Colossus); One Anole (Zeus); One Crestie (Noferatu); 3.0 Guinea Pigs (Paco, Poncho and Piccolo); 0.1 Pink Toe T (Azula)
Fish:
1.1 Oscar Cichlids (Rocky 1.0, hx2020, Red Fire, and Bubble 0.1, hx2019, Tiger), 1.1 Convict Cichlids (Hurley and Sloane), 0.1 Strawberry Peacock Cichlid (Comet), Two Plecos, Rubby the Rubbernose Pleco and Trinidad the common Pleco, 2.0 Upside Down Catfish (Poseidon, Neptune), One Red Parrot Cichlid (Firefly), 1.0 Betta Fish (Jenkins), 2.2 Cherry Barbs ("The Worst"), 1.0 Electric Blue Acara (Goldeneye)
-
The Following User Says Thank You to Archimedes For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|