» Site Navigation
0 members and 1,185 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,937
Threads: 249,129
Posts: 2,572,289
Top Poster: JLC (31,651)
|
-
Future pairings, thoughts and discussion. (everyone)
Hello everyone!
Well I bought a hatchling male that I will get soon to go with my year old female.
I plan to breed in two years.
She is a BEL (Less/moj) and he is a banana (male maker), Mojave, Black Pastel.
I don't know if she has any hidden genetics because I got her 3-4th handed and that's all they knew. Could be interesting when I get my first clutch in 2 years lol
Anyway that had me thinking. What are you all doing? Anybody have some cool projects they are working on or just some pet snakes that they are breeding?
Just curious and hope to see some awesome hatchlings. (Watching new hatchling videos has become a new addiction to me lol)
Sent from my SM-S767VL using Tapatalk
Sent from my SM-S767VL using Tapatalk
-
Re: Future pairings, thoughts and discussion. (everyone)
This is my female and the male I am getting.
https://uploads.tapatalk-cdn.com/202...8e5cc68c97.jpghttps://uploads.tapatalk-cdn.com/202...0273cd6721.jpg
I'm hoping he gets a nice grey background and freckles as he matures. I'm a little confused of if he will have the freckles or not. The black pastel supposed to increase the freckles in bananas but the Mojave lessens them. So Im thinking I will probably just have a few here and there, but I really don't know.
This is what morph market says the pairing will produce.
1/8 (4 gene [emoji3459])
3/8 (3 gene [emoji3459])
3/8 (2 gene [emoji3459])
1/8 (1 gene [emoji3459])
Half will be Banana (males) [emoji529]
3/8 will be BEL (2/3 of those being super mojave)
1/4 will be Black Magic (some with additional genes and half of those banana)
The rest are just other combinations of the genes.
What I am wanting out of the pairing is to produce more BEL and the Black magic. The banana is just for fun because I like seeing how banana combines with genes and makes some beautiful hatchlings.
Sent from my SM-S767VL using Tapatalk
-
Re: Future pairings, thoughts and discussion. (everyone)
I was at a reptile expo a few years ago and a guy had a table of nothing but banana morphs. It appeared that he had crossed banana with everything in his collection. I was surprised how many combinations of banana actually had lost color as hatchlings compared to a single gene specimen. No doubt the adults are likely to fade even further.
As for amusing projects: I have had possible Albino Hets kicking around in my population for a while and I finally confirmed breeders as 100% Het last year. One of them is a Het Albino/Het Pied female that has been consistently producing ringers. I am crossing her to a Lavender Albino male this season. I am interested to see if I can visually identify the double-het Albino/Lav Albinos vs. Het Albino and in the event I should happen to produce a triple het...if it will be a ringer of note. :)
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Lord Sorril
I was at a reptile expo a few years ago and a guy had a table of nothing but banana morphs. It appeared that he had crossed banana with everything in his collection. I was surprised how many combinations of banana actually had lost color as hatchlings compared to a single gene specimen. No doubt the adults are likely to fade even further.
As for amusing projects: I have had possible Albino Hets kicking around in my population for a while and I finally confirmed breeders as 100% Het last year. One of them is a Het Albino/Het Pied female that has been consistently producing ringers. I am crossing her to a Lavender Albino male this season. I am interested to see if I can visually identify the double-het Albino/Lav Albinos vs. Het Albino and in the event I should happen to produce a triple het...if it will be a ringer of note. :)
That's why I got the black pastel banana. I actually like the adult version better than the hatchling. It's one of the few bananas I've seen so far I like the adult better in. The purplish grey background with yellow spots is what I am hoping to get.
But nothing can beat a banana hatchling at impulse sales lol. Sadly most do know know that they change so much as they grow.
Are the albinos allylic with lavender albinos? The double hey may produce a visual. I know the candy is compatible with albino so I would think lavender albino would be also.
Sent from my SM-S767VL using Tapatalk
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Daniel_Effler
Are the albinos allylic with lavender albinos? The double hey may produce a visual. I know the candy is compatible with albino so I would think lavender albino would be also.
I'm fairly certain that the two albino types are not allelic---I know there is a lot of 'XYZ big breeder says so and so' about this morph combo and that, but, I like to observe personally. :)
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Lord Sorril
I'm fairly certain that the two albino types are not allelic---I know there is a lot of 'XYZ big breeder says so and so' about this morph combo and that, but, I like to observe personally. :)
Definitely let us know how it goes!
Sent from my SM-S767VL using Tapatalk
-
Re: Future pairings, thoughts and discussion. (everyone)
https://uploads.tapatalk-cdn.com/202...6982d9dabd.jpg
https://uploads.tapatalk-cdn.com/202...21a27599d3.jpg
Got the male I will be pairing with my female! Maybe next year if I’m lucky.
Sent from my iPhone using Tapatalk
-
Re: Future pairings, thoughts and discussion. (everyone)
I’m thinking my next set will be something to get albino clown but I also want another female with cinnamon so I can make some 8 ball. So I think my next will be an albino cinnamon het clown or cinnamon double het clown and albino.
But then that opens a whole can of worms on the different flavors of albino. Do I want to do straight albino or candy or toffee? If I go with one of the hets I could work towards a candinos or I could go a completely different route and do lavender albino. So many possibilities there. It’s hard to wrap my head around all the different variations and what makes them different from each other.
Sent from my iPhone using Tapatalk
-
Re: Future pairings, thoughts and discussion. (everyone)
I don't do breeding, don't really plan on doing it, Beans will stay my one-brain-celled emotin support for now lol. but it's really cool to hear about your breeding plans and such!
-
You got the BEL 3rd or 4th handed at only a year old, no knowledge of who bred it, what genes it may contain and you still want to breed it? How are you going to prevent any snakes you produce from ending up bouncing from home to home that quickly or worse? It's not only about what you make, it's about where those snake lives end up and when it's an animal that can live for 40+ years, I wish people would really consider where those babies go long term, not just what they may look like.
-
Re: Future pairings, thoughts and discussion. (everyone)
I have decided to focus on what I like and not whats the latest trend. That way if they are not good breeders I have pets I love and will keep regardless.
For me its Bels and most of the albino types. (with a few other morphs to enhance them) Oh I love normals too.
Quote:
Originally Posted by GoingPostal
How are you going to prevent any snakes you produce from ending up bouncing from home to home that quickly or worse? It's not only about what you make, it's about where those snake lives end up and when it's an animal that can live for 40+ years, I wish people would really consider where those babies go long term, not just what they may look like.
I think going for snakes that would make good pets and are pretty, breeding for temperament too and not just the latest trend (trends change) helps.
I never sold to pet shops. I also only sell to people who can prove they know what they are doing or have done their research which shows commitment.
Beyond that I don't know. I am not sure there are any guarantees.
Your point is of concern to me too. Do you have any advice?
-
Re: Future pairings, thoughts and discussion. (everyone)
Finding out what genes the BEL has is part of the fun of breeding. With any animals we breed we con not guarantee how they will end up. We hope for the best and you can vet the buyer to a certain degree but you can’t know for sure. That goes for any animal,snake dog, cat, fish.
But if people did not breed more or especially this kind of animal would be taken from the wild. The demand is there so why not bring some new life into the world?
I know many will disagree but that’s how I see it.
Sent from my iPhone using Tapatalk
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Daniel_Effler
But if people did not breed more or especially this kind of animal would be taken from the wild. The demand is there so why not bring some new life into the world?
I know many will disagree but that’s how I see it.
You make a good point too. For an extreme example I started breeding snakes in the dark ages when there were no captive bread. People only bought wild caught then and they did not last long.
I studied with the center for life studies (part of the British zoological sociaty) at london zoo, and amongst other people we built up captive populations.
For one example, My first rat snakes were wild caught because no captive bread were available. Now captive bread Rat snakes are the norm in collections and wild caught not needed and less likely to thrive. Yes captive breeding takes the pressure of wild populations.
I don't think we should not breed snakes, But I do think we should consider where they go and if they will be looked after.
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Ascended
I have decided to focus on what I like and not whats the latest trend. That way if they are not good breeders I have pets I love and will keep regardless.
For me its Bels and most of the albino types. (with a few other morphs to enhance them) Oh I love normals too.
I think going for snakes that would make good pets and are pretty, breeding for temperament too and not just the latest trend (trends change) helps.
I never sold to pet shops. I also only sell to people who can prove they know what they are doing or have done their research which shows commitment.
Beyond that I don't know. I am not sure there are any guarantees.
Your point is of concern to me too. Do you have any advice?
I feel our preferences if much the same. I’ll never be a big breeder, just a hobbist. I will probably only have 5-6 snakes and breed a clutch now and then. My favorites are the BEL, albino, banana, and clown. I want to eventually have an example of each of those to be a pet.
Sent from my iPhone using Tapatalk
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Ascended
You make a good point too. For an extreme example I started breeding snakes in the dark ages when there were no captive bread. People only bought wild caught then and they did not last long.
I studied with the center for life studies (part of the British zoological sociability) at london zoo, and amongst other people we built up captive populations.
For one example, My first rat snakes were wild caught because no captive bread were available. Now captive bread Rat snakes are the norm in collections and wild caught not needed and less likely to thrive.
I don't think we should not breed snakes, But I do think we should consider where they go and if they will be looked after.
I can agree with that.
Sent from my iPhone using Tapatalk
-
Re: Future pairings, thoughts and discussion. (everyone)
I gave you a rep for being brave enough to speak your mind while thinking you may be attacked for it. (sorry my rep power is zero though, its the thought)
Quote:
Originally Posted by Daniel_Effler
I feel our preferences if much the same. I’ll never be a big breeder, just a hobbist. I will probably only have 5-6 snakes and breed a clutch now and then. My favorites are the BEL, albino, banana, and clown. I want to eventually have an example of each of those to be a pet.
Sent from my iPhone using Tapatalk
Now that the politics are out of the way a bit.....
Our preferences are more similar than you realise. I like clowns too, for me firstly its the face the markings make. I mean it can look like a skull or something.
https://ball-pythons.net/forums/cach...a95ff1b885.jpg
But I am going to wait till they come down in price. As they are but also it would be awesome to have that look in an albino of some kind too.
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Ascended
I gave you a rep for being brave enough to speak your mind while thinking you may be attacked for it.
I just want to say before I start that no one attacks anyone on this site. A bit of friendly conversation/debate is pretty common but no one is saying anyone's a bad person. I think the concern here, and I don't want to speak for anyone else, but Daniel by their own admission just got their first BP a couple of months back, and here we are talking about breeding, and the ethics of breeding. That's not to say newer keepers can't breed or have opinions on breeding, I think Postal was just raising a pretty reasonable concern.
You guys don't get the wrong idea, no one's out to get anyone on this site, we're just concerned for the animals.
-
Re: Future pairings, thoughts and discussion. (everyone)
Its Ok I didn't mean they would be attacked here. But they were concerned and still spoke up. I respect that. so reps. (even if my reps have zero power)
Attacking views does happen on other sites, it has happened to me too. that's why I am on this site as opposed to any other sites.
There is respect, information and education here, through challenging in an informative way where needed.
Maybe daniel has seen the other style on other sites and that's why they were concerned. I have.
I was cautious at first until I learned it was different here, I was just encouraging them to speak their mind without fear. Because I feel its safe to do so here. even if the view is controversial.
If I did not feel it was safe here, I would have not posted publicly and sent them a private message saying be careful what you say here.
I an dyslexic, and asperses, forgive my lack of clear communication. And edits.
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Hugsplox
I just want to say before I start that no one attacks anyone on this site. A bit of friendly conversation/debate is pretty common but no one is saying anyone's a bad person. I think the concern here, and I don't want to speak for anyone else, but Daniel by their own admission just got their first BP a couple of months back, and here we are talking about breeding, and the ethics of breeding. That's not to say newer keepers can't breed or have opinions on breeding, I think Postal was just raising a pretty reasonable concern.
You guys don't get the wrong idea, no one's out to get anyone on this site, we're just concerned for the animals.
Good point for sure and all admit right now I am in pipe dream mode for sure. As I have said before it will be at least two years beginning I attempt any breeding and do not plan to purchase any more snakes until then. I’m going slow and learning as I go :)
One reason for making this thread was just talk and discuss ideas and opinions so I except everyone’s opinion even if it is different than mine.
That said I really did not feel attacked just supporting my opinion. I fully excepted I am very new and have a lot to learn and everyone has different beliefs and feelings.
Big python hugs for all!
Sent from my iPhone using Tapatalk
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Ascended
I gave you a rep for being brave enough to speak your mind while thinking you may be attacked for it. (sorry my rep power is zero though, its the thought)
Now that the politics are out of the way a bit.....
Our preferences are more similar than you realise. I like clowns too, for me firstly its the face the markings make. I mean it can look like a skull or something.
https://ball-pythons.net/forums/cach...a95ff1b885.jpg
But I am going to wait till they come down in price. As they are but also it would be awesome to have that look in an albino of some kind too.
To me my dream python in either a banana clown or albino clown but I agree the price is way up there right now.
Sent from my iPhone using Tapatalk
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Daniel_Effler
Hello everyone!
She is a BEL (Less/moj) and he is a banana (male maker), Mojave, Black Pastel.
I don't know if she has any hidden genetics because I got her 3-4th handed and that's all they knew. Could be interesting when I get my first clutch in 2 years lol
Sent from my SM-S767VL using Tapatalk
Its difficalt for the best breeders to know what other morphs are in a Bel. The Lesser mojave is quite predictable, but the black pastel would only be proved with breeding out in my opinion. As for any other hidden genetics, its possible as the Bel's whiteness hides other morphs.
One way that you can try and see other morph patterns it to shine a UV light on it. That sometimes shows other hidden Morph patterns.
Breeding out to a normal is the best way though.
New to ball pythons but not breeding snakes, so other members please contradict freely or advise further.
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Ascended
Its difficalt for the best breeders to know what other morphs are in a Bel. The Lesser mojave is quite predictable, but the black pastel would only be proved with breeding out in my opinion. As for any other hidden genetics, its possible as the Bel's whiteness hides other morphs.
One way that you can try and see other morph patterns it to shine a UV light on it. That sometimes shows other hidden Morph patterns.
Breeding out to a normal is the best way though.
New to ball pythons but not breeding snakes, so other members please contradict freely or advise further.
Sounds right. I am fairly certain of the black pastel due to how brown my banana is. He just shed so I should get some fresh pics. The black pastel typically increases the banana freckles but the Mojave suppresses them so it’s hard to tell on that note, not to mention he is still young and from what I understand the freckles increase with age. I can see a few small ones on him now.
Here is more pics of my boy
https://uploads.tapatalk-cdn.com/202...ff2678b137.jpg
https://uploads.tapatalk-cdn.com/202...54f959c7ae.jpg
https://uploads.tapatalk-cdn.com/202...83f54603e8.jpg
Sent from my iPhone using Tapatalk
-
I have a male bel (moj/les) and am curious on what some good pairings ideas would be for him in the future for breeding.
-
Re: Future pairings, thoughts and discussion. (everyone)
I must have missed this thread because it started when I was absolutely slammed with pairing my adults and getting all my sub-adults upgraded to adult enclosures. There are two main projects I'm working on right now with BP's. Making darker panda pieds with less issues using suma cinnamon instead of super cinny/black pastel is one that I'm in the very early stages of. Justin certainly beat me to the punch and has produced them already, but I imagine that as hard as they are to produce, they will continue to be in high demand for a very long time. The other is to try out some different YB complex acts-like-supers with banana enchi. Some of my girls in the second project have morphs in the blue eyed lucy complex also, and it will be interesting to see what those add to the mix as well. I have lots of ideas on the back burner sticking with those for now.
Quote:
Originally Posted by BEL
I have a male bel (moj/les) and am curious on what some good pairings ideas would be for him in the future for breeding.
My top choice around $600 or less to pair with a male moj/les BEL would be a banana enchi. You would have a chance first generation clutches to get 3-gene combos that look pretty stunning. If you are trying to pick up an already mature female, you choices are going to be pretty limited and you may not find that available, certainly not for that price.
If you want something you can get a running start with by picking up a mature female, a pinstripe or pastel pinstripe might be a much easier one to obtain that still would produce pretty nice results without spending a fortune.
It's certainly not the most exciting thing in the world to hatch, but pairing him with any of the blue eyed lucy complex morphs in het form should give you %50 BEL, which seem to be pretty in demand lately. Maybe a bamboo because those are one of the better looking hets that sell for more?
If you are just getting started I wouldn't go pairing him to 4-6 different females because it's a lot to manage your first time, I'd stick with 1-2 to get your feet wet.
Wish everyone awesome results this year, I'm super excited to start hatching out soon and see how I faired with odds!
-
Re: Future pairings, thoughts and discussion. (everyone)
Ok so hopefully will get my first paring off this year.
I got a female that is around 1800g (albino, cinnamon, mojave, het pied) I got a hatching male to pare her with but he may not be up to the task this year ..... And I think I messed up [emoji1751]
So he is an (albino, black pastel, mojave, het pied)
I was thinking that will be cool I could make some cherry bombs and albino pieds!
But I have come to realize that there are several other combinations that could happen and I may not be able to tell them apart at all. So I'm not sure if I am going to move forward with this one or not in the future. I definitely have to do more research and figure out if I can identify the hatchlings from that pairing. I would hate to have to put (possible any combination of these genes) good luck [emoji1696]
I could still pair with my banana male and have the possibility of making BEL and 8 bal that would be het albino.
I am trying to get my BEL female up to a comfortable size but it may be fall before she gets there.
Sent from my SM-S426DL using Tapatalk
-
Re: Future pairings, thoughts and discussion. (everyone)
Sounds like you are going to have quite a bit of fun with all those combos. You never have enough BEL, or albino pieds, cherry bombs. They are all in high demand. I have a continuing project with candino and albino pairing. That’s been a productive pairing for me for a couple of years now. Good luck going forward. :gj:
-
There would be some that you couldn't really ID fully but I still thinks that's a pretty good pair.
-
I think a good blacklight may be a worthwhile purchase for that pair. It can at least maybe help you ID BEL and BEL pieds in a pinch I think.
The white on pieds will typically show up as a nice solid white under blacklight. BELs can have some residual patterning that shows up under it. So I would think a BEL showing up under blacklight with larger patches of solid white would be the BEL pied. An old post floating around here said a pied BEL had an interesting side pattern on the body, but there really isn't any info to go on for it aside from test breeding later on.
Like Nikkubus said, some you can't fully ID, because another thing to keep in mind is that Black pastel, Cinny and Pieds can sometimes lead to an all white hatchling as well.
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Armiyana
I think a good blacklight may be a worthwhile purchase for that pair. It can at least maybe help you ID BEL and BEL pieds in a pinch I think.
The white on pieds will typically show up as a nice solid white under blacklight. BELs can have some residual patterning that shows up under it. So I would think a BEL showing up under blacklight with larger patches of solid white would be the BEL pied. An old post floating around here said a pied BEL had an interesting side pattern on the body, but there really isn't any info to go on for it aside from test breeding later on.
Like Nikkubus said, some you can't fully ID, because another thing to keep in mind is that Black pastel, Cinny and Pieds can sometimes lead to an all white hatchling as well.
I have a blacklight but it's just a bulb from Walmart and it is not the best. I will buy one of those black light flashlights that you can but to look for scorpions. That will help a lot.
Yes I did not think it all the way though but with this at least I should be able to pick out pieds. Thanks.
------
I also kinda wish I had got a better breeder clown male. I got a single gene clown male. I could have got a lot more profit out of a 3-4 gene male and single gene female instead of the other way around.
Sice it will be a while anyway (hatchling) do you all think I should sale the clown male and upgrade to a multiple gene clown male now or just play it out with what I have?
What I have intended to pair with him is a leopard het clown female and a firefly het clown female.
I do have a few other females also but none that are het clown or visual.
Sent from my SM-S426DL using Tapatalk
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Daniel_Effler
I also kinda wish I had got a better breeder clown male. I got a single gene clown male. I could have got a lot more profit out of a 3-4 gene male and single gene female instead of the other way around.
Sice it will be a while anyway (hatchling) do you all think I should sale the clown male and upgrade to a multiple gene clown male now or just play it out with what I have?
What I have intended to pair with him is a leopard het clown female and a firefly het clown female.
I do have a few other females also but none that are het clown or visual.
Sent from my SM-S426DL using Tapatalk
It just really depends on what kind of projects you are shooting for. If it were me, I'd probably pair him with those two hets and try to get a nice holdback male before I sold him rather than just buying one outright unless he is still pretty small and nowhere near breeding size anyways. I feel like after taking the time to grow him, might as well see if you can hit a Leopard Clown or Firefly Clown male.
-
Re: Future pairings, thoughts and discussion. (everyone)
I would keep the single gene male clown because he will be able to breed in probably less than a year. There have been anecdotal reports of male balls breeding at early ages and surprisingly lower weights. Some that may not necessarily being seen to be producing sperm plugs. Most have gone on to successfully sire clutches. Any clown is a worthy keeper to me. Consider putting him( once he has a reasonable weight and size) to all your intended females. I’m actively putting my 10 month old red stripe yellow belly 66% Het clown male to a unproven first time coral glow female possible Het clown. There have been a couple of locks over the past weeks.
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Albert Clark
I would keep the single gene male clown because he will be able to breed in probably less than a year. There have been anecdotal reports of male balls breeding at early ages and surprisingly lower weights. Some that may not necessarily being seen to be producing sperm plugs. Most have gone on to successfully sire clutches. Any clown is a worthy keeper to me. Consider putting him( once he has a reasonable weight and size) to all your intended females. I’m actively putting my 10 month old red stripe yellow belly 66% Het clown male to a unproven first time coral glow female possible Het clown. There have been a couple of locks over the past weeks.
Awesome! Good luck with that pairing. I bet you will make some awesome babies there. I love the look of a banana clown.
Sent from my SM-S426DL using Tapatalk
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Daniel_Effler
Awesome! Good luck with that pairing. I bet you will make some awesome babies there. I love the look of a banana clown.
Sent from my SM-S426DL using Tapatalk
Thank you D! I’m excited about the possibilities. Just wish she was 66% or 100% het. Only one way to find out if she proves out as a sole possible. Lol. Good luck with your projects.
-
Re: Future pairings, thoughts and discussion. (everyone)
This is my current plan with what I have.
You will see that I have two almost identical males here and that's because one got out and was nowhere to be found for 3-4 months. I gave up on him and had gotten a replacement. After I get the replacement he showed back up in the bathroom floor one day.
This is my working plan.
1) With the first trio I am looking to create albino pieds, cherry bombs, and Panda pieds.
2) This trio is just a simple clown trio looking to make if I hit the best odds a leopard clown and a firefly clown.
3) this is the duplicate banana I bought but I do know this one is a female maker so I'm using it with what I feel is the stronger contenders to be paired with the two bananas. Looking to make some bamboo Mojave BEL, and some just stunning banana combinations hopefully.
4) The next trio I am looking to create 8 Ball and BEL I do not know if this is a male or female maker.
5) really not sure if I'm going to move forward with these pairings or not. I got this male without Really a plan. I feel that what I am pairing him with could make some very nice snakes but of course they will all be just het candy. I may move one of these up to a different category later on and see about getting another candy or het candy to work with. I am personally not real big on combining the candy and toffee genes with albino as I think it can get confusing so I probably will not breed him to my albino female.
https://uploads.tapatalk-cdn.com/202...453c1e4a2c.jpg
Hoping to get 1-2 breed this year. The albino female is big enough and my BEL girl is right on the edge.
Sent from my SM-S426DL using Tapatalk
-
This seems like a really neat project!
I guess my only 2 cents to the matter is:
The female pastel fire Enchi in group 5 that you're unsure on...might be a good one to toss to one of the banana Mojave boys. Personal bias because of of my favs is my Coral Glow Mojave fire gal. (Opal in my gallery)
Good luck!
-
I think those are some pretty solid choices. Hope it goes well for you!
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Daniel_Effler
Awesome! Good luck with that pairing. I bet you will make some awesome babies there. I love the look of a banana clown.
Sent from my SM-S426DL using Tapatalk
Hey D, don’t sleep on the young males you have. Also, their ability to sire clutches at lower weights and younger ages.
-
Re: Future pairings, thoughts and discussion. (everyone)
Quote:
Originally Posted by Daniel_Effler
That's why I got the black pastel banana. I actually like the adult version better than the hatchling. It's one of the few bananas I've seen so far I like the adult better in. The purplish grey background with yellow spots is what I am hoping to get.
But nothing can beat a banana hatchling at impulse sales lol. Sadly most do know know that they change so much as they grow.
Are the albinos allylic with lavender albinos? The double hey may produce a visual. I know the candy is compatible with albino so I would think lavender albino would be also.
Sent from my SM-S767VL using Tapatalk
This is a great thread highlighting differences in albino and lavender albino. Allellic or not Allellic? Questions answered.
- Thread Tools
- Search Thread
- Display
- 06-09-2020, 03:01 PM
Kingdomall
https://ball-pythons.net/forums/imag...er-offline.png
Registered Userhttps://ball-pythons.net/forums/imag...tation_pos.pnghttps://ball-pythons.net/forums/cust...tar82443_1.gifJoin Date06-07-2020Posts41Thanks0Thanked 14 Times in 8 Posts
Albino and Lavender
Hello there,
I'm sure this question has been asked many, many times (yet I couldn't find an answer). But, is there a genetic difference between albino and lavender albino?
Say I breed a lav albino and an albino. will all babies be normals but with het albino/lav albino, or will they combine?
If it's a genetic difference and the genes don't mix like that, then I'm truly intrigued as to how these two genes separated like this.
Thanks.
Last edited by Kingdomall; 06-09-2020 at 03:05 PM.
Thanks Blog this Post
- 06-09-2020, 03:07 PM
Stewart_Reptiles
https://ball-pythons.net/forums/imag...er-offline.png
Telling it like it is!https://ball-pythons.net/forums/imag...tation_pos.png https://ball-pythons.net/forums/imag...tation_pos.png https://ball-pythons.net/forums/imag...tation_pos.png https://ball-pythons.net/forums/imag...tation_pos.png https://ball-pythons.net/forums/imag...tation_pos.png https://ball-pythons.net/forums/imag...on_highpos.png https://ball-pythons.net/forums/imag...on_highpos.png https://ball-pythons.net/forums/imag...on_highpos.png https://ball-pythons.net/forums/imag...on_highpos.png https://ball-pythons.net/forums/imag...on_highpos.png https://ball-pythons.net/forums/imag...on_highpos.pnghttps://ball-pythons.net/forums/cust...ar4173_105.gifJoin Date09-28-2006Posts24,840Thanks6,116Thanked 20,797 Times in 9,579 PostsBlog Entries1Images: 6
Re: Albino and Lavender
https://ball-pythons.net/forums/imag...quote_icon.png Originally Posted by Kingdomall https://ball-pythons.net/forums/imag...post-right.png
Hello there,
I'm sure this question has been asked many, many times (yet I couldn't find an answer). But, is there a genetic difference between albino and lavender albino?
Say I breed a lav albino and an albino. will all babies be normals but with het albino/lav albino, or will they combine?
If it's a genetic difference and the genes don't mix like that, then I'm truly intrigued as to how these two genes separated like this.
Thanks.
They are not the same and are not compatible so if you were to breed Lavender to Albino you would get some Double Hets, by breeding those double hets you would have 1/16 chance to produce a Double Recessive however will it be different or easily idenfiable it not likely.
Thanks Blog this Post
- The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
- 06-09-2020, 03:38 PM
PartySnake13
https://ball-pythons.net/forums/imag...er-offline.png
Registered Userhttps://ball-pythons.net/forums/imag...tation_pos.pnghttps://ball-pythons.net/forums/cust...tar78183_2.gifJoin Date07-03-2019Posts98Thanks145Thanked 27 Times in 19 Posts
Re: Albino and Lavender
https://ball-pythons.net/forums/imag...quote_icon.png Originally Posted by Kingdomall https://ball-pythons.net/forums/imag...post-right.png
Hello there,
I'm sure this question has been asked many, many times (yet I couldn't find an answer). But, is there a genetic difference between albino and lavender albino?
Say I breed a lav albino and an albino. will all babies be normals but with het albino/lav albino, or will they combine?
If it's a genetic difference and the genes don't mix like that, then I'm truly intrigued as to how these two genes separated like this.
Thanks.
There are numerous locations where a spontaneous mutation can occur, causing the disruption of one step in the melanin production process and resulting in an albino snake.
The albino and lavender albino genes are located on different alleles, therefore if bred together the offspring will still have one working melanin production gene at both alleles.
For example, Albino and Candy are located on the same allele, therefore breeding them together will produce an intermediate form of albinism known as a candino.
When breeding an Albino to a Lavender Albino each parent passes on one copy of their different albino gene and one normal gene for the opposing form of albino.
A lavender albino has 2 normal alleles for albino; an albino has 2 normal alleles for lavenderalbino.
Producing visual/ double homologous lavender albino albinos would likely be an waste of time/ resources, only resulting in an albino looking animal with a possible pattern influence from the lavender trait, as the albino gene's inability to produce blue pigment would likely dominate the lavender albino genes colors, and at the end of the day there are much more rewarding double het projects.
Last edited by PartySnake13; 06-09-2020 at 03:47 PM.
Thanks Blog this Post
- 06-09-2020, 07:31 PM
Kingdomall
https://ball-pythons.net/forums/imag...er-offline.png
Registered Userhttps://ball-pythons.net/forums/imag...tation_pos.pnghttps://ball-pythons.net/forums/cust...tar82443_1.gifJoin Date06-07-2020Posts41Thanks0Thanked 14 Times in 8 Posts
Re: Albino and Lavender
thank you for your responses, I appreciate it greatly
Thanks Blog this Post
- The Following User Says Thank You to Kingdomall For This Useful Post:
- 06-10-2020, 09:10 AM
asplundii
https://ball-pythons.net/forums/imag...er-offline.png
BPnet Veteranhttps://ball-pythons.net/forums/imag...tation_pos.png https://ball-pythons.net/forums/imag...tation_pos.png https://ball-pythons.net/forums/imag...tation_pos.png https://ball-pythons.net/forums/imag...tation_pos.png https://ball-pythons.net/forums/imag...tation_pos.png https://ball-pythons.net/forums/imag...on_highpos.pngJoin Date10-17-2008Posts901Thanks101Thanked 703 Times in 374 Posts
Re: Albino and Lavender
https://ball-pythons.net/forums/imag...quote_icon.png Originally Posted by PartySnake13 https://ball-pythons.net/forums/imag...post-right.png
The albino and lavender albino genes are located on different alleles, therefore if bred together the offspring will still have one working melanin production gene at both alleles.
For example, Albino and Candy are located on the same allele, therefore breeding them together will produce an intermediate form of albinism known as a candino.
As a point of clarification:
Alleles are different versions of the same gene. So Albino and Candy are alleles which is why they are compatible and make the heteroallelic Candino
Albino and Lav are two completely different, unrelated genes. Because of this, they are not alleles
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
Thanks Blog this Post
+ Reply to Thread
Your Message
Title: https://ball-pythons.net/forums/clear.gif
[COLOR=#000000][FONT=Arial][TABLE="class: cke_editor, width: 673"]
[TR]
[TD="class: cke_top"] FontSize
|