» Site Navigation
0 members and 1,337 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,209
Posts: 2,572,701
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
Registered User
newbie to genetics question.
k im just starting to research and learn ball genetics and i have a nebie ?. i have a facination with the BEL's and am curious about them.i would like to produce one and now i know some of the morphs that make them, my ? is can you produse more than one in a clutch and do you get them in every clutch or does it happen sometimes or what. if i breed 2 mojave's do automaticly get them. is it like taking 2 albinos are all young BEL's.
what are some good books to get me started on genetics.
thanks all help.
Eric
-
-
BPnet Veteran
Re: newbie to genetics question.
mojave x mojave = 25% Normal, 50% Mojave, 25% Super Mojave (BlueEL)
but those are the theory, but seen, people got a whole clutch of BlueEL.
-
-
Re: newbie to genetics question.
Breeding 2 mojaves, by statistics 1 of every 4 eggs should be a BEL, but its all a stroke a luck, you may get 1, more that one, or none at all. Theres no way to govern what the genes go inside the egg.
I'm not sure if I understand what your saying with the albinos, but you couldn't compare a albino with a mojave.
Albino x Albino = all albino babies
BEL x BEL = All BEL babies
Het albino x Het albino = more Het's, some normals and maybe some albinos
Mojave x Mojave = more mojaves, some normals and maybe BELs
You could just say Mojave is one of the 'Visual' Hets for BEL, along with Lessers, Russos, and Butters, as well as Fires which make Black Eyed Lucys when bred with another Fire.
0.1 GHI Mojave
0.1 Super special h scaleless
0.1 Desert ghost
1.0 WC Dinker
-
-
Registered User
Re: newbie to genetics question.
thanks that awnsered my ? perfectly. sorry for the cloudy ?. you get all albino babies when you cross two albinos. that was my ? if when you cross 2 mojave's do you get all bels. thats perfect answer. so the bel is a resecive gene correct?
does one of the morphs that produse bells seem to have a higher chance of producing one, over the other or is even odds with them all.
thanks
eric
-
-
Re: newbie to genetics question.
 Originally Posted by ericswan_1
so the bel is a resecive gene correct?
No. The heterogygous animals have a dominant phenotype to the wildtype gene and the BluEL is an animal homozygous for that gene.
does one of the morphs that produse bells seem to have a higher chance of producing one, over the other or is even odds with them all.
There is no indication that any of the het BluEL morphs are more prone to throwing BluELs when bred together
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: newbie to genetics question.
Albino is recessive, since het albinos you couldnt visualy tell them from normals
Mojave is codominant cause you can clearly tell a mojave from a normal, the only reason I used the term 'visual het or het mojave' was to illustrate how you couldnt compare a mojave to a albino but I see how I kinda made that a little confusing. The correct term would be Codominant, 2 mojaves would make a BEL .
2 Het Albinos would make an Albino
I'm just trying to keep it to simple words , not everyone knows what 'phenotype' means
0.1 GHI Mojave
0.1 Super special h scaleless
0.1 Desert ghost
1.0 WC Dinker
-
-
Registered User
Re: newbie to genetics question.
thats makes sence.
thanks
-
-
Re: newbie to genetics question.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: newbie to genetics question.
 Originally Posted by EdShal
mojave x mojave = 25% Normal, 50% Mojave, 25% Super Mojave (BlueEL)
but those are the theory, but seen, people got a whole clutch of BlueEL.
To clarify this post the percentage is per egg. So lets say you have 3 eggs. You then could have
3 Normals
2 Normals 1 Mojave
2 Normals 1 BEL
1 Normal 2 Mojaves
1 Normal 2 BELs
1 Normal 1 BEL 1 Mojave
2 Mojaves 1 BEL
3 Mojaves
3 BELS
I will let someone who has worked with probability more recently figure out the odds. Very often people who are new to genetics and have never been burned by its randomness get some bad luck and think that the impossible happened. You are rolling a 4 sided die for every egg and hopping for a 4. You can role 10 times and not get a single 4 or you can role 10 times and get 10 4s, its all chance.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|