Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 664

1 members and 663 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,117
Posts: 2,572,191
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 4 of 4

Thread: Different Womas

  1. #1
    BPnet Senior Member WingedWolfPsion's Avatar
    Join Date
    09-27-2007
    Location
    Plattsmouth, NE
    Posts
    5,168
    Thanks
    124
    Thanked 1,785 Times in 1,134 Posts
    Images: 1

    Different Womas

    I've recently heard that NERD is considering its line of Womas to be possibly genetically different from typical Womas from different sources.

    NERD has determined that Pearl, (Homozygous woma) is lethal. Does anyone know of people have bred Womas from other bloodlines together to produce pearls? I'm curious to know if both lines of Womas are homozygous-lethal.
    --Donna Fernstrom
    16.29 BPs in collection, 16.11 BP hatchlings
    Eclipse Exotics
    http://www.eclipseexotics.com/
    Author Website
    http://donnafernstrom.com
    Follow my Twitters: WingedWolfPsion, EclipseMeta, and EclipseExotics

  2. #2
    BPnet Lifer mainbutter's Avatar
    Join Date
    09-30-2008
    Location
    Washington, DC
    Posts
    5,690
    Thanks
    269
    Thanked 1,374 Times in 1,053 Posts
    Images: 7

    Re: Different Womas

    it would be VERY interesting to see a breeding from hidden line womas to "regular" womas

  3. #3
    BPnet Veteran
    Join Date
    06-23-2005
    Location
    Montreal, Canada
    Posts
    343
    Thanks
    81
    Thanked 54 Times in 41 Posts

    Re: Different Womas

    I don't think he said his woma were different line, but they were carring another gene.

    Well, I don't know if he proved that gene could be isolated from the woma or not. But that's what I tought.

    I would also like to know about more about the Pearl being lethal. I don't know how many breeders actually produced Pearl. I think a lot, just put their female woma to other project instead thinking it wasn't worth the try.

    Woma are not as commun as spiders or some other gene. But I believe we should see more cross with it in the next few years. And may be more will try it with the Pearl. Just hope people let us know about it.

  4. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Different Womas

    In another forum the nature of NERD's hidden gene Womas was discussed in some detail. In that thread it was said by someone I trust that NERD brought in 2 different animals that looked similar and were initially considered the same but which Kevin now believes are different. I am still on the fence as to whether the Type I and Type II (for lack of better terms) are genetically distinct or simply alleles of the same gene. At this point there is not enough info, though I have asked if Kevin did a Type I x Type II breeding and was told that question would be relayed to Kevin.

    The Pearl is the super form of the Type I and is indeed lethal. It is unknown if Kevin tried to produce a super form of the Type II and I think that might be a worth while progect as well.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1