Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,031

2 members and 1,029 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,141
Posts: 2,572,339
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 6 of 6

Thread: Bel vs bel.

  1. #1
    BPnet Veteran FIEND_FO_LYFE's Avatar
    Join Date
    04-13-2008
    Location
    Washington
    Posts
    1,292
    Thanks
    267
    Thanked 191 Times in 157 Posts
    Images: 3

    Bel vs bel.

    ive got a BEL question...

    if you bred a Russo Het, to a fire, you wouldn't get BELs right, but if you took, fire russos and bred them together youd get blue and black eyed bels?


    if my theory is correct, that might be the coolest clutch ever lol

  2. #2
    Do I get Paid for this??? LadyOhh's Avatar
    Join Date
    07-25-2006
    Location
    Southern California
    Posts
    7,578
    Thanks
    1,364
    Thanked 2,115 Times in 1,073 Posts
    Blog Entries
    1
    Images: 7

    Re: Bel vs bel.

    Quote Originally Posted by FIEND_FO_LYFE View Post
    ive got a BEL question...

    if you bred a Russo Het, to a fire, you wouldn't get BELs right, but if you took, fire russos and bred them together youd get blue and black eyed bels?


    if my theory is correct, that might be the coolest clutch ever lol
    Yes.
    Heather Wong
    I AM the Wonginator
    Heather's Herps Website
    READ MY BLOG!!!
    Balls for Life, Baby!!!

  3. The Following User Says Thank You to LadyOhh For This Useful Post:

    FIEND_FO_LYFE (06-12-2009)

  4. #3
    BPnet Veteran FIEND_FO_LYFE's Avatar
    Join Date
    04-13-2008
    Location
    Washington
    Posts
    1,292
    Thanks
    267
    Thanked 191 Times in 157 Posts
    Images: 3

    Re: Bel vs bel.

    i now know my breeding projects lol

  5. #4
    Apprentice SPAM Janitor MarkS's Avatar
    Join Date
    07-22-2005
    Location
    St Paul, MN
    Posts
    6,209
    Thanks
    1,535
    Thanked 2,678 Times in 1,596 Posts
    Blog Entries
    9
    Images: 3

    Re: Bel vs bel.

    Well, actually if you bred a Het Russo, to a fire (also a het) then each egg would have the possibility of being 1 of 4 forms, each with a 25% chance of happening... Each egg would have a 25% chance of being either a normal, a het Russo, a fire (het black eyed Leucistic) or a combination animal that was both Het Russo and fire.

    If you could produce a male and a female that were both het russo and fire combined then you could raise them up and breed them together in a few years and have the possibility of producing up to 9 different forms with different percentages of each possibility. Each egg would have a percentage chance of being one of these forms, they are;

    6.25% chance of Normal
    12.5 % chance of Het Russo
    12.5% chance of fire
    25% chance of Het Russo and fire
    12.5% chance of Blue Eyed Leucistic het fire
    12.5% chance of Black Eyed Leucistic het Russo
    6.25% chance of Blue Eyed Leucistic
    6.25% chance of Black Eyed Leucistic
    6.25% chance of Blue Eyed Leucistic AND Black Eyed Leucistic in one animal (can't even imagine what that would look like)

    Sounds like a pretty long project. But potentially rewarding.
    Draco dormiens nunquam titillandus

  6. The Following User Says Thank You to MarkS For This Useful Post:

    FIEND_FO_LYFE (06-12-2009)

  7. #5
    BPnet Veteran FIEND_FO_LYFE's Avatar
    Join Date
    04-13-2008
    Location
    Washington
    Posts
    1,292
    Thanks
    267
    Thanked 191 Times in 157 Posts
    Images: 3

    Re: Bel vs bel.

    Quote Originally Posted by MarkS View Post
    Well, actually if you bred a Het Russo, to a fire (also a het) then each egg would have the possibility of being 1 of 4 forms, each with a 25% chance of happening... Each egg would have a 25% chance of being either a normal, a het Russo, a fire (het black eyed Leucistic) or a combination animal that was both Het Russo and fire.

    If you could produce a male and a female that were both het russo and fire combined then you could raise them up and breed them together in a few years and have the possibility of producing up to 9 different forms with different percentages of each possibility. Each egg would have a percentage chance of being one of these forms, they are;

    6.25% chance of Normal
    12.5 % chance of Het Russo
    12.5% chance of fire
    25% chance of Het Russo and fire
    12.5% chance of Blue Eyed Leucistic het fire
    12.5% chance of Black Eyed Leucistic het Russo
    6.25% chance of Blue Eyed Leucistic
    6.25% chance of Black Eyed Leucistic
    6.25% chance of Blue Eyed Leucistic AND Black Eyed Leucistic in one animal (can't even imagine what that would look like)

    Sounds like a pretty long project. But potentially rewarding.
    it def sounds like fun to me.
    im 18 so ive got time!! lol
    ill be attempting mojo X lesser BELs next season...
    it just would be cool to get suck a combo of snakes in a single clutch.

  8. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Bel vs bel.

    Quote Originally Posted by MarkS View Post
    6.25% chance of Blue Eyed Leucistic AND Black Eyed Leucistic in one animal (can't even imagine what that would look like)
    I suspect it would look like the animal Eric has that is believed to be a super sulfur/super mojo. It is a BlkEL with patches on it that are whiter than the base white. Speculation is that these white patches are the areas that in a super sulfur (i.e. super fire) would normally be yellow but have had the colour removed by the animal also being super mojo.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    FIEND_FO_LYFE (06-12-2009),MarkS (06-15-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1