» Site Navigation
0 members and 661 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Registered User
recessive, co-dom, dominate
I have been trying to read up on all the genetics that I can and one of the things that confuses me is that I dont know how to tell the difference between recessive, dominant, and co-dom. I was just curious if anyone knows of any good site to go to that I can learn how to tell the difference between the various types of bp's, co-dom/dom/recessive etc etc etc..........
Any help would be much appreciated!
Thank you
1.2 normal 0.1 pinstripe
1.1 spider 1.0 butter
2.0 pastel
0.1 mojave
-
-
Banned
Re: recessive, co-dom, dominate
 Originally Posted by rocky88
I have been trying to read up on all the genetics that I can and one of the things that confuses me is that I dont know how to tell the difference between recessive, dominant, and co-dom. I was just curious if anyone knows of any good site to go to that I can learn how to tell the difference between the various types of bp's, co-dom/dom/recessive etc etc etc..........
Any help would be much appreciated!
Thank you
http://www.ballpython.ca/genetics.html
-
-
Re: recessive, co-dom, dominate
Try here. I don't know how to visually see if an animal has a recessive trait, but this website has descriptions about the morphs and it will say recessive, dominant, co-dominant.
http://www.royalvariations.com/index...d=35&Itemid=95
I'll keep looking, I know there is a lot of information out there. I do know a recessive trait will only show up in an animal that is bred to another either with that trait, or het for that trait. For example: Albino X Normal will not give you any visual albinos only het for albinos. They look normal, but can produce albinos.
"Be not afraid of greatness: some are born great, some achieve greatness, and some have greatness thrust upon them." ~William Shakespeare
1.1 Normals - Apollo & Medusa
1.0 Pastel - Zeke
0.1 Pastel het OG - Dixie
0.1 Pastel het Axanthic
0.1 Spider het Axanthic
1.1 Mojave - Clyde & Bonnie
1.0 Black Pastel - Conan
0.1 Spider - Dizzy
-
-
Re: recessive, co-dom, dominate
Quick List off the top of my Head:
RECESSIVE:
Albino
Piebald
Genetic Stripe
Axanthic
Ghost/Hypo
Clown
CO-DOM:
Spider
Pinstripe
Woma
Pastel
Enchi
Sable
Black Pastel
Cinnamon
Mojave
Lesser
Butter
Fire
Het Russo
Vanilla
Yellowbelly
There are plenty more, but that is some of them
-
-
Re: recessive, co-dom, dominate
I'm not sure what you mean about how to tell the difference between recessive, co-dom, and dominate.
If you just want a list of which morphs are recessive and which ones are co-dom, etc, I am not aware of any place that lists all the morphs. However, here are a few places which list a lot of them:
NERD's site. Lots of beautiful pics. Click on the one that interests you and you'll get even more beautiful pics, plus info on whether the morph is recessive, etc, as well as whether it is a combo and what morphs combine to produce it.
http://www.newenglandreptile.com/ner...ollection.html
Ralph Davis's site. Not so many pics, and sometimes the info hasn't been updated recently (like it may say he hopes to try for a super in 2002 or something). This link is actually the page for albino, but there is a drop down menu in the top right with lots of other base morphs.
http://www.ralphdavisreptiles.com/ma...its/albino.asp
If you are asking about how one figures out whether a new morphs is recessive, co-dom, or dominant, you have to do breeding trials.
-
-
Re: recessive, co-dom, dominate
To add on to heathers list
Ressesives
Lavender albino
Tristripe
Patternless
- Matt
Come here little guy. You're awfully cute and fluffy but unfortunately for you, you're made of meat
-
-
Registered User
Re: recessive, co-dom, dominate
No I'm not really looking for a list. I just want to be able to tell which ones are recessive, co-dom etc... All of you experienced bp people, if I came to you and said what is a clown or what is a spider or what is an albino, axanthic, piebald, pastel, normal, etc..... How do you know if it is recessive or co-dom, dom? Did you just learn to kinda memorize which are which and now it's just second nature. Or is there some kind of method behind knowing???? Sorry if I am confusing you and you cant figure out what I'm asking. I'm just so confused on the subject
1.2 normal 0.1 pinstripe
1.1 spider 1.0 butter
2.0 pastel
0.1 mojave
-
-
BPnet Veteran
Re: recessive, co-dom, dominate
You find out by breeding. Recessives, doms, and codoms have specific chances of offspring.
MH
Who the hell is Pat?
"Pattimuss doesn't run, he prances most delicately, like a beautiful but sad fairy, winged and capped, curly toed shoes on each foot, dancing on dewdrops while lazy crickets play soft music for him to keep time by...." - Wes
-
-
Re: recessive, co-dom, dominate
 Originally Posted by rocky88
No I'm not really looking for a list. I just want to be able to tell which ones are recessive, co-dom etc... All of you experienced bp people, if I came to you and said what is a clown or what is a spider or what is an albino, axanthic, piebald, pastel, normal, etc..... How do you know if it is recessive or co-dom, dom? Did you just learn to kinda memorize which are which and now it's just second nature. Or is there some kind of method behind knowing???? Sorry if I am confusing you and you cant figure out what I'm asking. I'm just so confused on the subject  
Yes, you just have to memorize it. After a while, it does become second nature.
-
-
Re: recessive, co-dom, dominate
 Originally Posted by DutchHerp
You find out by breeding. Recessives, doms, and codoms have specific chances of offspring.
 Originally Posted by kc261
Yes, you just have to memorize it. After a while, it does become second nature.
I'll echo these statements but go a little further off of what Dutch said.
Recessive, dominant and co-dominant (used incorrectly, but what are you gonna do???) have very specific trend when you breed.
For a recessive trait, the only way you have a visual morph is if you have 2 copies of the mutant gene. Any animals with only one copy of the mutant gene (i.e. hets) are phenotype normal.
For a dominant trait, animals that are homozygous for mutant gene and animals that are heterozygous for mutant gene have the same phenotype.
For a co-dom trait, animals that are heterozygous for the mutant gene have a different phenotype than normals and animals that are homozygous for the mutant have a different phenotype than the heterozygous animals.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|