Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

> FAQ

» Online Users: 1,447

0 members and 1,447 guests

No Members online

Most users ever online was 9,191, 03-09-2025 at 12:17 PM.

» Today's Birthdays

Jkexotiics21 (37)

» Stats

Members: 75,868
Threads: 249,062
Posts: 2,571,950
Top Poster: JLC (31,651)

Welcome to our newest member, elizard

Results 1 to 1 of 1

Thread: Katydids: Looking for

Thread Tools
- Show Printable Version
Display
- Linear Mode
- Switch to Hybrid Mode
- Switch to Threaded Mode

02-11-2009, 08:45 AM #1
asplundii

View Profile

View Forum Posts

View Blog Entries

View Gallery Uploads
BPnet Veteran

Join Date

10-17-2008

Posts

906

Thanks

103

Thanked 722 Times in 382 Posts
Katydids: Looking for

Trying to find katydids to use as feeders. Anyone know a source?

actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
Reply With Quote

Quick Navigation Non-Rodent Feeders Top

« Previous Thread | Next Thread »

Posting Permissions

You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
[VIDEO] code is On
HTML code is Off

Powered by vBadvanced CMPS v4.2.1

All times are GMT -4. The time now is 07:18 AM.

Copyright © 2003-2025 Ball-Pythons.net. All Rights Reserved.