Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 669

1 members and 668 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,105
Posts: 2,572,111
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 2 of 2
  1. #1
    BPnet Veteran
    Join Date
    08-23-2008
    Location
    Winnipeg, Manitoba, Canada
    Posts
    491
    Thanks
    164
    Thanked 58 Times in 57 Posts
    Images: 2

    Can someone explain to me the differences

    I was looking forward in getting a Jaguar carpet this Springand my friend was telling me he knows somone who will have 88%IJ jags and 75% Coastal Jags. So my question is how do you get the % of the mix which ones will be the more brighter(yellower) and also if anyone has any pictures of these.
    Thanks Mark
    0.1.0 Albino Jungle (Diva)
    0.0.1 Leo Gecko(Loki)
    1.0.0 Leo Gecko(Nova)
    1.0.0 Spider Ball( Svita)
    0.1.0 Pewter BP ( Cloud)
    0.1.0 Het Orange Ghost ( Morgana)
    1.0.0 Piebald ( Boo)
    0.1.0 Piebald (Pandora)
    0.1.0 88%IJ JAG( Halo)
    1.0.0 Jungle Jag(Winter)
    1.0.0. Clown ( Echo)
    1.0.0 Albino Mojave ( Frost)

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Can someone explain to me the differences

    You get the percentage of mix based on how many sequential breedings to a specific type you have.

    So, for the 88% IJ you start with a Jag and breed to a IJ. All those offspring are 50% IJ
    Breed a 50% IJ Jag to an IJ and all those offspring will be 75% IJ
    Breed a 75% IJ Jag to an IJ and all those offspring will be 88% IJ

    As for which will be most yellow... I can not say for certain. Lots of people argue that the IJ Jags are more yellow but I have seen some screamers that were not IJ

    For pics, try moreliapythons.com
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1