Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 716

1 members and 715 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,905
Threads: 249,105
Posts: 2,572,111
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 2 of 2
  1. #1
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Rock solid uriates?

    So had an odd thing happen and wanted to get advice on it as I have never seen this before.

    My chondro was looking a little on the fat side this week and it had been a while since she had passed anything so I decided to forgo feeding her till she went. Yesterday, I discovered she had gone and while removing it from the cage I noticed that the uriates were basically rock hard spheres. I do not recall her having passed these before and I have never come across it in any of my other snakes over the years so I want to see if this is a normal thing chondros sometimes do or if I need to be keeping an eye on her for something. In every other respect she is healthy; great feed response, good colour, normal activity level, alert...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #2
    BPnet Senior Member Brandon Osborne's Avatar
    Join Date
    08-14-2008
    Location
    Indiana
    Posts
    1,225
    Thanks
    217
    Thanked 693 Times in 350 Posts
    Images: 5

    Re: Rock solid uriates?

    It is a pretty common occurence in chondros. If it worries you, just give her a good warm soaking and see what happens. A good solid rain usually makes them do their "doodie" as well. Good luck.

    Brandon
    Brandon Osborne

    Like Osborne Reptiles on Facebook!
    http://www.facebook.com/osbornereptiles
    Take a look at our website!
    www.osbornereptiles.com

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1