Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,732

0 members and 1,732 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,098
Threads: 249,242
Posts: 2,572,928
Top Poster: JLC (31,651)
Welcome to our newest member, nightfallvt
Results 1 to 7 of 7
  1. #1
    Registered User LemonDroops's Avatar
    Join Date
    10-08-2019
    Posts
    6
    Thanks
    0
    Thanked 1 Time in 1 Post

    (HELP w/ Isopods) BIO ACTIVE VIVARIUM

    I want to set up a bio active vivarium for my ball pythons and Mexican black king snake. I have four terrariums in total. I highlighted my questions and organized them into categories.

    40 gallon (Female Ball Python)
    40 gallon (Female Ball Python)
    30 gallon (Male Ball Python)
    10 gallon (Mexican Black King Snake)


    ISOPODS: I have 30 powder blue and 100 dwarf white isopods in total. How many isopods should I use for each terrarium? Should I continuously add more over time to ensure they colonize successfully in my terrariums? Once they are in there, should I do anything else other than add leaf litter/ cork bark to help them survive?

    ISOPOD CARE:
    I currently have the isopods in separate containers. (Blue top for POWDER BLUES and red top for WHITE DWARFS) pics below. I don't have any palm bark so am using cork. I boiled leaves I gathered from outside (Maple & Oak). The substrate is coco fiber with sphagnum moss and I make sure to maintain the humidity in the dwarf white container. Is there anything I can do to improve my cultures? Are there any other ways to sterilize leaves?

    SPRING TAILS: I currently don't have any on hand but hope to find some at the reptile convention later this month. How many should I add into each terrarium? Do you know where I could get some now in Canada? Would it be ok if I add the isopods before the spring tails?

    SCALE ROT: As I'm doing research, I find that scale rot becomes an issue when it comes to bio active set ups. I added lots of substrate to ensure there were layers for water to drain down so the top would stay dry (pics below of my tanks). How else can I protect my snakes from scale rot? Are there any other risks I should take in account other than scale rot?

    MY SETUP:
    I want my snakes to have a natural experience and full life in captivity. I don't just want them to survive but to thrive instead. I have artificial plants as I don't get sufficient sunlight in my room but I would be happy to add low light plants, I just haven't found any good ones yet. Is there anything I can add to my terrariums to enrich their experience or overall improve their health? Are there any low light plants that you've had success with?

    SPOT CLEANING:
    I find that some people choose to take out feces while some leave them in the setup, same with urate. I thought the clean up crew would be responsible for breaking down the waste. What should I take out when I spot clean? Should I ever remove the decorations and scrub them clean?

    Thank you for your time & response in advance. If you see any fault or flaw in my care, please let me know. I always believe there is room for improvement and would appreciate your honest opinion.




  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: (HELP w/ Isopods) BIO ACTIVE VIVARIUM

    Quote Originally Posted by LemonDroops View Post
    How many isopods should I use for each terrarium? Should I continuously add more over time to ensure they colonize successfully in my terrariums? Once they are in there, should I do anything else other than add leaf litter/ cork bark to help them survive?
    If your set up is done properly then you should only need to add them once and they will begin to reproduce on their own and become self sustaining. How many you add depends on how quickly you want a sizable population to establish and how much you want to spend. If you are willing to throw $100 into each cage then get multiple colonies and they should stabilize pretty quickly. If you only have $10 to put into each cage then it will take longer until their population really takes hold


    Quote Originally Posted by LemonDroops View Post
    ISOPOD CARE: [/B]I currently have the isopods in separate containers. (Blue top for POWDER BLUES and red top for WHITE DWARFS) pics below. I don't have any palm bark so am using cork. I boiled leaves I gathered from outside (Maple & Oak). The substrate is coco fiber with sphagnum moss and I make sure to maintain the humidity in the dwarf white container. Is there anything I can do to improve my cultures? Are there any other ways to sterilize leaves?
    Leaves and cork are fine. If you want to throw the occasional carrot or sweet potato slice in you can do that but that also increases the odds of fungus and gnats and stuff.

    Boiling is the best way to sterilize but you can also bake them in the oven at 200F for a couple hours. Just stay in the kitchen while you do that because sometimes they can catch fire.



    Quote Originally Posted by LemonDroops View Post
    SPRING TAILS: I currently don't have any on hand but hope to find some at the reptile convention later this month. How many should I add into each terrarium? Do you know where I could get some now in Canada? Would it be ok if I add the isopods before the spring tails?
    See above re: How many isopods to add. And it is fine to add the isopods first, they are not going to out-compete the springs


    Quote Originally Posted by LemonDroops View Post
    SCALE ROT: As I'm doing research, I find that scale rot becomes an issue when it comes to bio active set ups. I added lots of substrate to ensure there were layers for water to drain down so the top would stay dry (pics below of my tanks). How else can I protect my snakes from scale rot? Are there any other risks I should take in account other than scale rot?
    Scale rot comes from sitting in excess moisture and urates. If you are keeping the enclosure correctly you should not have either.


    Quote Originally Posted by LemonDroops View Post
    MY SETUP: I want my snakes to have a natural experience and full life in captivity. I don't just want them to survive but to thrive instead. I have artificial plants as I don't get sufficient sunlight in my room but I would be happy to add low light plants, I just haven't found any good ones yet. [B]Is there anything I can add to my terrariums to enrich their experience or overall improve their health? Are there any low light plants that you've had success with?
    English ivy varieties and pothos do well in low light. Added bonus that their vining growth means you can start with a small piece and they spread. Only caution I would add here is that you probably want to let them establish in and grow before adding the snakes because fresh cuttings and active snakes makes for cuttings that get plowed around and do not root


    Quote Originally Posted by LemonDroops View Post
    SPOT CLEANING: I find that some people choose to take out feces while some leave them in the setup, same with urate. I thought the clean up crew would be responsible for breaking down the waste. What should I take out when I spot clean? Should I ever remove the decorations and scrub them clean?
    Bioactive is not self-cleaning, especially with larger animals like snakes. If you see urates/feces then remove them. The clean-up crews are in place to help with the small amounts that you cannot clean or miss when cleaning
    Last edited by asplundii; 02-06-2020 at 08:36 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Aerries (02-06-2020),nikkubus (11-04-2021),sam.i.am (04-26-2022)

  4. #3
    BPnet Veteran wnateg's Avatar
    Join Date
    07-25-2019
    Location
    TX
    Posts
    837
    Thanks
    684
    Thanked 1,020 Times in 465 Posts
    Last edited by wnateg; 02-06-2020 at 12:53 PM.
    Start your own dubia roach colony with Roach Rancher!

    Instagram - @AliceAnaconda

    0.1.0 Cat "Anna"
    -----
    1.1.0 Emerald Tree Boa "Amanda & Samantha"
    0.1.0 Merauke Scrub Python "Victoria"
    0.1.0 Titanium Reticulated Python "Alice"
    1.0.0 Eastern Indigo
    -----
    0.0.4 Alligator Snapping Turtle "Deborah"
    0.0.2 Florida Snapping Turtles
    0.0.1 Cuvier's Dwarf Caiman "Caroline"
    0.0.1 100% Het Black Dragon Asian Water Monitor
    -----
    0.0.1 Antilles Pink Toe Tarantula "Katherine"

  5. The Following User Says Thank You to wnateg For This Useful Post:

    nikkubus (11-04-2021)

  6. #4
    BPnet Veteran Aerries's Avatar
    Join Date
    02-16-2017
    Location
    Kissimmee Fl
    Posts
    951
    Thanks
    343
    Thanked 948 Times in 460 Posts
    Images: 16

    Re: (HELP w/ Isopods) BIO ACTIVE VIVARIUM

    Quote Originally Posted by asplundii View Post
    If your set up is done properly then you should only need to add them once and they will begin to reproduce on their own and become self sustaining. How many you add depends on how quickly you want a sizable population to establish and how much you want to spend. If you are willing to throw $100 into each cage then get multiple colonies and they should stabilize pretty quickly. If you only have $10 to put into each cage then it will take longer until their population really takes hold




    Leaves and cork are fine. If you want to throw the occasional carrot or sweet potato slice in you can do that but that also increases the odds of fungus and gnats and stuff.

    Boiling is the best way to sterilize but you can also bake them in the oven at 200F for a couple hours. Just stay in the kitchen while you do that because sometimes they can catch fire.





    See above re: How many isopods to add. And it is fine to add the isopods first, they are not going to out-compete the springs




    Scale rot comes from sitting in excess moisture and urates. If you are keeping the enclosure correctly you should not have either.




    English ivy varieties and pothos do well in low light. Added bonus that their vining growth means you can start with a small piece and they spread. Only caution I would add here is that you probably want to let them establish in and grow before adding the snakes because fresh cuttings and active snakes makes for cuttings that get plowed around and do not root




    Bioactive is not self-cleaning, especially with larger animals like snakes. If you see urates/feces then remove them. The clean-up crews are in place to help with the small amounts that you cannot clean or miss when cleaning
    I can say that is 100% accurate. I have my Normal Ball- Ramsey in a Bioactive with spring tails, Powder Orange, and Dwarf White ISO’s and all I do is spray the pothos once a week and spot clean any urates and poos.....substrate is a combo of potting soil, coconut fibre, and cypress, with sphagnum moss and leaf litter.....it’s a total game changer. I waited two weeks but I breed my own ISO’s and spring tails so I dumped a lot to better establish quicker. As far as the pathos....they’re exploding and they were clipping from my Pixie frogs enclosure and are doing amazingly


    Sent from my iPhone using Tapatalk

  7. #5
    Registered User Naginii's Avatar
    Join Date
    09-07-2019
    Posts
    46
    Thanks
    8
    Thanked 32 Times in 22 Posts

    Re: (HELP w/ Isopods) BIO ACTIVE VIVARIUM

    Quote Originally Posted by LemonDroops View Post


    MY SETUP:
    I want my snakes to have a natural experience and full life in captivity. I don't just want them to survive but to thrive instead. I have artificial plants as I don't get sufficient sunlight in my room but I would be happy to add low light plants, I just haven't found any good ones yet. Is there anything I can add to my terrariums to enrich their experience or overall improve their health? Are there any low light plants that you've had success with?

    SPOT CLEANING:
    I find that some people choose to take out feces while some leave them in the setup, same with urate. I thought the clean up crew would be responsible for breaking down the waste. What should I take out when I spot clean? Should I ever remove the decorations and scrub them clean?



    I can't answer everything but it seems like you have gotten some good advice anyways. I wanted to touch on these two questions though. A spider plant is a wonderful low light plant. I have kept them in darker shelves in my office with super indirect light and they still grow like champs. They do send out runners once established and you may have to take those runners out if you find yourself short on space. They do well with constant moist soil or dry periods. I just love them! Plus they look neat lol.

    I would say to spot clean until your colony is fully established and after that, take out anything still left after 24 hours. That's my plan anyways. I've heard of people not needing to spot clean with a really mature clean up crew but I can't personally attest to that as I am just getting started myself. You shouldn't ever have to remove decorations to scrub them, anything like mold or fungi should be eaten by the clean up crew and all I can see it doing is removing bacteria that you probably want in the tank. Hope this helps!

  8. #6
    Registered User Claire&snek's Avatar
    Join Date
    07-01-2021
    Location
    Greenville SC
    Posts
    119
    Thanks
    6
    Thanked 13 Times in 12 Posts

    Re: (HELP w/ Isopods) BIO ACTIVE VIVARIUM

    Hi guys! Ran across this old thread and wanted to add something... I as well am hoping to do a bioactive for my ball python. Where could I find everything that I might need for a bioactive enclosure for a ball python. (A good link/list/or previous thread that I might be able to use) this would be very helpful!
    Last edited by Claire&snek; 10-11-2021 at 10:20 PM.

  9. #7
    Registered User
    Join Date
    10-31-2021
    Posts
    12
    Thanks
    0
    Thanked 8 Times in 5 Posts
    I keep quite a few species of isopods as well as have a bioactive setup so hopefully I can answer a few questions!

    For starters, chose one isopod or the other. Dwarf white reproduce via parthenogenesis and are very prolific. They will outcompete any other isopod in the enclosure and you'll eventually just have all dwarf whites. Both are a good choice. Dwarf whites you will never see as they live mostly below the substrate. Powders will be a bit more active and personally I find them fun to watch. You also have to be extra careful using dwarf whites if you have any other cultures because all it takes is a single pod to slip into another culture or bioactive setup for them to take over. Most people don't even keep whites in the same room as other pods. I would recommend adding at least 30 to your bioactive. This is a good breeding population and should quickly explode. You won't need to add more as long as they don't have a die off. Make sure you keep a back up culture!

    The bark and leaves is enough for them to survive and they will also devour snake sheds and pretty much any other organic matter. Cork bark is good, any other hardwood bark will work as well. I get all my bark and leaves from outside. I use mainly oak for both. To sterilize I bake in the oven at 250 for 20 minutes. I do that for basically anything I take from outside.

    To keep your isopod cultures healthy, you need a nutritious substrate which coco fiber is not. I use a mix of hydrated hardwood pellets, top soil and sand. This is what I use in all my isopod cultures as well as all my ball python setups, even the ones that aren't bioactive. It's very cheap to make and is probably my favorite substrate I have ever used honestly. Make sure you have a moisture gradient. Keep a pile of moss on one corner, usually about 1/4 the tub and keep that hydrated. Too dry and they dessicate, too moist and they drown. They need to be able to regulate their own moisture needs so have a moist and a dry side is preferred, though both dwarfs and powders are pretty hardy.

    To be honest, if you have isopod cultures you more than likely have springtails. I have never purchased springtails or intentionally added them yet they are in all my isopod bins and my bioactive setup. They are small and hitchhike easily. If you do decide to purchase some, just dump the whole culture in. Most cultures sold in stores and online are small starter cultures. You could get two and have one to start culturing your own as well.

    You can absolutely add your springtails later. You don't necessarily need to have both, they just work together well to make healthy soil and do different jobs. Like I said, you probably have some springtails in your isopod cultures already as well.

    As for scale rot, just make sure your ball pythons humidity needs are correctly met and then provide one or two spots of sphagnum moss that you keep wet for the isopods to retreat to when they need moisture and you shouldn't have to worry about scale rot.

    For the terrarium, just add lots of naturalistic stuff. The leaves,.moss, and bark for the pods make an enclosure look really nice. Throw in some real branches, maybe some rocks if you want. Ball pythons like clutter. I don't have any recommendations for low light plants, but the plants I have in mine are spider plant, Boston fern, pothos, and aloe. My favorite is the Boston fern. Balls will crush most plants but the Boston ferns have very fibrous stems and can handle the crushing well. I like the pothos as well. They will get crushed, but they seem to tolerate it well and perk back up quickly. The spider plant looks nice but it gets pretty flattened, though still thriving just fine. I'm indifferent on the aloe. It holds up well to the crushing but just looks a little out of place in my setup.

    Contrary to popular belief, isopods won't eat much poop or urates. They might nibble on poo, but won't get rid of it. That's just my experience with powders and poo, maybe other species enjoy it more. You should spot clean as needed if it starts to build up, but it's also good for the soil. I would only remove the decorations for cleaning if they get soiled.

    Sorry that was a really long post! I kind of rambled. I just love isopods and bioactive setups so wanted to dump all my knowledge and experience!

  10. The Following User Says Thank You to Frosted For This Useful Post:

    nikkubus (11-04-2021)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1