Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,238

0 members and 1,238 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,129
Posts: 2,572,292
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Page 1 of 4 1234 LastLast
Results 1 to 10 of 31
  1. #1
    Registered User tickyyy's Avatar
    Join Date
    01-05-2019
    Location
    Vancouver, WA
    Posts
    490
    Thanks
    93
    Thanked 128 Times in 57 Posts
    Images: 17

    Spider Ball Python ban and breeding

    I am aware of the controversy surrounding spider ball pythons and the ethical issue of breeding these snakes when they have a neurological issue such as the spider wobble. I am writing a paper on the issue and I just want to see everyone's opinion on the issue and why they believe in that opinion. I hope my paper sheds some light on this issue in the ball python community. :)
    do the jah

  2. The Following User Says Thank You to tickyyy For This Useful Post:

    Craiga 01453 (12-11-2019)

  3. #2
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    7,008
    Thanks
    2,526
    Thanked 4,965 Times in 3,027 Posts

    Re: Spider Ball Python ban and breeding

    Quote Originally Posted by tickyyy View Post
    I am aware of the controversy surrounding spider ball pythons and the ethical issue of breeding these snakes when they have a neurological issue such as the spider wobble. I am writing a paper on the issue and I just want to see everyone's opinion on the issue and why they believe in that opinion. I hope my paper sheds some light on this issue in the ball python community.

    Sooooooo I used to have a stunning Caramel Albino Spider and it had ZERO wobble !!

    Interestingly it was THE best feeder I’ve ever had !!


    Sent from my iPhone using Tapatalk Pro




  4. #3
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    7,008
    Thanks
    2,526
    Thanked 4,965 Times in 3,027 Posts

    Re: Spider Ball Python ban and breeding

    Quote Originally Posted by Zincubus View Post
    Sooooooo I used to have a stunning Caramel Albino Spider and it had ZERO wobble !!

    Interestingly it was THE best feeder I’ve ever had !!


    Sent from my iPhone using Tapatalk Pro




    Sent from my iPhone using Tapatalk Pro




  5. The Following User Says Thank You to Zincubus For This Useful Post:

    tickyyy (12-11-2019)

  6. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Speaking as a scientist (broadly) and a geneticist (specifically) my opinion is that:

    1) All Spiders (and affiliated morphs) have the issue to some degree. There are none that are completely free of it.

    2) The root of the controversy is being generated by people with little to no actual scientific background making assertions based off of anthropomorphized generalizations and personal feelings
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following 10 Users Say Thank You to asplundii For This Useful Post:

    Craiga 01453 (12-11-2019),ladywhipple02 (12-11-2019),MattEvans (12-11-2019),mdb730 (12-11-2019),paulh (12-11-2019),PghBall (12-12-2019),PitOnTheProwl (12-11-2019),Stewart_Reptiles (12-11-2019),tickyyy (12-11-2019),Toad37 (12-11-2019)

  8. #5
    BPnet Lifer ladywhipple02's Avatar
    Join Date
    07-26-2005
    Location
    Greensburg, Indiana
    Posts
    2,667
    Thanks
    432
    Thanked 955 Times in 400 Posts
    Images: 11

    Re: Spider Ball Python ban and breeding

    Quote Originally Posted by asplundii View Post

    2) The root of the controversy is being generated by people with little to no actual scientific background making assertions based off of anthropomorphized generalizations and personal feelings

    Haven't logged in in awhile, been lurking as a guest here and there, but it's been super busy lately. However, I felt compelled to log in simply to "like" this comment. Cheers to that!

  9. The Following User Says Thank You to ladywhipple02 For This Useful Post:

    asplundii (12-12-2019)

  10. #6
    Sometimes It Hurts... PitOnTheProwl's Avatar
    Join Date
    11-21-2010
    Location
    San Antonio, TX
    Posts
    12,050
    Thanks
    6,313
    Thanked 6,985 Times in 4,274 Posts
    Images: 3
    Too many people say their spider/combo doesn't wobble....
    Too many people say they shouldn't be bred....

    Both are blind to the other.
    Very few are open minded.

    Having several spider genes in my collection, they are some of the best feeders I have and were the easiest to switch to FT.
    BTW there are more morphs that wobble...

  11. The Following User Says Thank You to PitOnTheProwl For This Useful Post:

    Craiga 01453 (12-11-2019)

  12. #7
    BPnet Veteran Luvyna's Avatar
    Join Date
    01-06-2019
    Posts
    836
    Thanks
    1,336
    Thanked 833 Times in 491 Posts

    Re: Spider Ball Python ban and breeding

    This may be unpopular opinion judging by responses so far, but I am personally against the breeding of spiders and I think it's right to ban them. Even with spiders that don't exhibit severe symptoms, we are only able to judge the effects of the wobble by behaviour we can observe and since (as far as I am aware) there have never been studies on if spiders have elevated stress levels and other relevant factors, and snakes are not very expressive, we can't know if they are suffering or not, and how much, if they are.

    This aside, knowingly producing animals that may not be able to feed or move normally seems unfair to me. Even if it is just one out of many snakes that will experience symptoms that severe, that is still a living creature that was brought into the world to suffer needlessly by choice. And before anyone brings up this argument, yes, I feel the same way about dog and cat breeds that are known to have health-jeopardizing defects like pugs and Scottish folds, and about any other animals that are bred as pets despite known health problems.

    With that said, I can also understand why people like spiders and find them desirable. They are beautiful. One of the first BP morphs I ever saw was a banana spider, and I think it is still one of the most beautiful BPs I've ever seen. I won't hold my opinions against anyone who owns spiders, but I would personally never get one or support breeding them.

  13. The Following User Says Thank You to Luvyna For This Useful Post:

    tickyyy (12-11-2019)

  14. #8
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6
    The bashing spider movement is from people who generally know nothing, never owned a spider, never bred them but heard from someone who heard from someone who watch a video once . Sure they wobble to a degree however train wrecks are rare, in most cases it will be hardly noticeable at all and if kept properly a Spider will thrive and do exactly the same things any other BP with any other paint job will do.

    Ironically Spiders are the focus of the bashing when other mutations who exhibit the same issue are left alone if people wanted to be fair their would bash those other mutations as well.

    Another irony most people that you will find against the spider gene have no issue with some dogs such as bulldogs, chihuahuas to name a few who have health issues and rarely can give birth naturally.

    It's simple you like spider own them, you don't like them don't own them, but saying something should be ban is a slippery slope to ban anything and everything all together because one person disagrees with it.

    The majority of breeders are ethical and care and will cull anything that will not have quality of life, in the years I used to work with spiders (I no longer do since I focus on Pied now) I have never had to cull a spider I have however had to cull other animals however that would not have thrive or have a quality of life......that comes with breeding.
    Deborah Stewart


  15. The Following User Says Thank You to Stewart_Reptiles For This Useful Post:

    tickyyy (12-11-2019)

  16. #9
    Registered User
    Join Date
    02-17-2019
    Posts
    7
    Thanks
    1
    Thanked 11 Times in 3 Posts
    I have one, and even after months of proper care, she still wobbles. :| I don't know why so many breeders act as if the wobble isn't an issue. When we changed my girl's substrate, it was ridiculous. She was flailing, arching every which way, ect. She's not the only rescue bp in this house, but she's the only spider rescue and the only one to have such a worrying reaction. Despite being rescued from similar conditions.

  17. #10
    Registered User
    Join Date
    05-25-2018
    Posts
    134
    Thanks
    43
    Thanked 150 Times in 69 Posts
    Images: 4

    Re: Spider Ball Python ban and breeding

    Quote Originally Posted by Phantomfugue View Post
    I have one, and even after months of proper care, she still wobbles. :| I don't know why so many breeders act as if the wobble isn't an issue. When we changed my girl's substrate, it was ridiculous. She was flailing, arching every which way, ect. She's not the only rescue bp in this house, but she's the only spider rescue and the only one to have such a worrying reaction. Despite being rescued from similar conditions.
    Rescues are in need of rescuing because of the poor condition of the husbandry and animal. Poor husbandry such as too much heat will cause further damage making the symptoms worse. So yeah if the person you got him from or yourself were'nt using a thermostat to control the heat i could see that causing permanent damage. Add 10° f to the average human body temperature and it causes brain damage.
    Last edited by MattEvans; 12-11-2019 at 03:50 PM.

Page 1 of 4 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1