» Site Navigation
0 members and 1,227 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
|
-
Registered User
animal plastics advice
okay sooo here’s the thing. Pretzel is getting quite large and no longer fits in his small cage (which is 24 inches long i think) He is over a year old and appears to be almost done growing but probably still has a bit more to go. He is way too large for the cage and can’t really stretch out, so i’ve had to take him out most days to let him stretch out and move on the floor.
So I’ve been looking into getting an animal plastics cage. However I still live at my parents house and therefore pretzel is on my dresser. If i got a new cage they said the only place i can put it is downstairs in this cabinet we have( the new cage won’t fit on my dresser as it’s quite small) , so i can shut the cabinet doors when people come over who aren’t snake fans. the cabinet would only fit a t4 which is (36L by 24W by 15h). However I am nervous; will that size be good for a full grown ball python his whole life? The t10 (48L by 24W by 15H) seems better but it wouldn’t fit in the cabinet and i’d have no place to put it. Is it worth it to wait to move out and get the t10? I am planning on moving out in around a year or maybe less if things go well. I just feel so bad right now he seems very cramped in his cage and there’s very little room for him to move and stretch out. Thanks :-)
Sent from my iPhone using Tapatalk
-
-
Re: animal plastics advice
The T4 might get a little tight for a large adult BP. I definitely like the T10 option better but I understand you don't want to buy (2) adult enclosures. Perhaps you could find a large tub to house him in until you can get the T10. Tubs are pretty inexpensive to set up.
Last edited by EL-Ziggy; 05-06-2019 at 06:13 PM.
3.0 Carpet Pythons, 1.1 Bullsnakes
1.0 Olive Python 1.0 Scrub Python,
1.0 BI, 0.1 BCO
-
The Following User Says Thank You to EL-Ziggy For This Useful Post:
-
Given the most popular size tub for adult ball pythons is 41qts and given the dimensions of 41qt Sterilite tubs are 34 7/8" L x 16 5/8" W x 6 1/8" H I would dare to say that a 36" x 24" x 15" would be perfectly adequate...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
What about purchasing a stand for the t10 and putting it in your room?
0.1 Normal ball python Astrid
1.0 banana bumblebee Samwise
1.0 San Mattais rosy boa Charlie
1.0 bearded dragon Gimli
1.0 crested gecko Mr. Lizard
-
The Following User Says Thank You to reptilemom25 For This Useful Post:
-
Registered User
Re: animal plastics advice
i would do that but my room is very cramped and i would have to remove my dresser, and then i would have no room for my clothes haha
Sent from my iPhone using Tapatalk
-
-
Re: animal plastics advice
 Originally Posted by pretzelpretzel
i would do that but my room is very cramped and i would have to remove my dresser, and then i would have no room for my clothes haha
Sent from my iPhone using Tapatalk
Would your parents perhaps consider a larger dresser to accommodate the bigger enclosure?
0.1 Normal ball python Astrid
1.0 banana bumblebee Samwise
1.0 San Mattais rosy boa Charlie
1.0 bearded dragon Gimli
1.0 crested gecko Mr. Lizard
-
The Following User Says Thank You to reptilemom25 For This Useful Post:
-
Re: animal plastics advice
 Originally Posted by pretzelpretzel
i would do that but my room is very cramped and i would have to remove my dresser, and then i would have no room for my clothes haha
Sent from my iPhone using Tapatalk
In my opinoin snakes > clothes Just walk around nekkid
-
The Following 2 Users Say Thank You to sur3fir3 For This Useful Post:
Kerimac (05-10-2020),pretzelpretzel (05-07-2019)
-
Re: animal plastics advice
I have the enclosures in my bedroom set up on a storage rack I got at Home Depot. I live in a small apartment so I don’t have much space, sounds like you have a similar situation. Definitely something worth checking out as it saves massive amounts of space. My apartment is less than 600 sqft and I have 7 enclosures, all of which are pretty large. The racks can be dressed up with plants and what not to make them more aesthetically pleasing as well
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to MarkL1561 For This Useful Post:
-
Registered User
Re: animal plastics advice
i wish i could get a larger dresser but it wouldn’t fit in the room..
thanks everyone for the advice, i have many options to consider now )
Sent from my iPhone using Tapatalk
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|