Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 954

0 members and 954 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,140
Posts: 2,572,330
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Page 1 of 2 12 LastLast
Results 1 to 10 of 17
  1. #1
    Registered User
    Join Date
    02-16-2017
    Location
    Florida
    Posts
    20
    Thanks
    9
    Thanked 27 Times in 12 Posts

    Spider Morph Head Wobble Hypothesis

    Hi all, I don't believe I've ever made a post here, but for my first one I wanted to share a hypothesis I came up with for the cause of head wobble in spider ball pythons (and their allelic sisters). I made a short youtube video where I explain some of the background info which I'll provide a link to. This topic isn't meant to advertise the video, but I want it available for anyone looking for a bit more info or just something to listen to. I'll post it at the bottom of the topic for anyone interested .

    My hypothesis is that the spider morph originates from a mutation in a morphogen producing gene known as bone morphogenetic protein #4 or BMP4. Morphogens are responsible for the development of tissue throughout the body, and while there are a few dozen morphogens and currently 20 BMPs, BMP4 seems the most likely candidate based off several factors which I'll get into for those interested.

    Balance

    So I first made the assumption (which many others before me have as well) that spider ball pythons' head wobble was mainly a balance issue since spiders are capable of lying completely still and really only exhibit head wobble while moving or preparing to strike prey. This is a good indication that head wobble and balance are directly related, which then links head wobble to the inner ear which is the epicenter of balance in not only snakes but nearly all terrestrial vertebrates. As it happens, the morphogen BMP4 is responsible for both the formation and function of the inner ear, and while nothing directly proves this is the case in snakes, a study in 2016 [1] showed a homologous link between hair, scales, and feathers and that BMP4 signalling was causative in all cases. Therefore I feel at least relatively confident that BMP4 signalling is similar in both mammals and reptiles and therefore is responsible for inner ear development in both clades.

    Head Wobble/Poor Head Stability

    Interestingly, a study [2] looking at heterozygous BMP4 negative (BMP4 +/-) mice found some extremely similar behavior in these BMP4+/- mice and those in spider ball pythons. Surprisingly, the BMP4+/- mice demonstrated an odd circling behavior during normal movement which was actually found to be caused by poor balance by the researchers. Further, the mice were also found to have poor head stability in the yaw axis. Both of these ideas seem to be related very closely to the odd movements observed in head wobble, and normally, from my observations, spider ball pythons are far more confident in their left/right head movement than they are in their up/down head movement which normally results in corkscrews.

    Coloration/Pattern

    In looking for links between hair, feathers and scales, researchers [1] found a link between scale structure and formation, and BMP4 signalling gradients. Further, another top candidate for skin signalling in reptiles, WNT, was also found to be mitigated by BMP4 [3]. Essentially, the presence of BMP4 protein influences the coloration and patterning of the developing snake/vertebrate, and a change in the amount of BMP4 present during development would alter the appearance of the animal. So if spider ball pythons have a mutation to their BMP4 gene which reduces the available BMP4 during development, it would follow that this would also lead to a pleiotropic change in pattern and color almost regardless of the main reptile signalling pathway due to BMP4's extensive involvement in scale and skin structure seen in other vertebrates.

    Super Fatals

    So as I'm sure many of you know, a super spider ball python does not survive past the first few weeks of life assuming it even hatches alive. In the mouse study [2] it was observed that those mice who were homozygous negative for their BMP4 gene (BMP4-/-) would actually die during development. In the presence of no BMP4, they simply failed to get past the first few developmental stages. This would make it appear as though super spider ball pythons have at least a scant amount of BMP4 since they manage to develop mostly or that other pathways manage to keep it developing until later stages until it inevitably dies. OWALreptiles in their super spider post managed to hatch out a living super spider which died soon after birth. After taking it to the vet for a quick necropsy the vet found it to have a deformed spine. Interestingly, there are many studies (I'll link one [4]) that demonstrate the close link between BMP4 and dorsal spinal cord development. Without enough BMP4, the spinal cord did not fully form and the spine was the clear indication of that deformation.

    Black Head And Phantom

    I'll keep these as short as I can. Essentially black head and spider are allelic but black head shows no signs of head wobble and a black head spider ball python looks nearly normal. This is because instead of a mutation to the BMP4 gene causing a reduction in the BMP4 protein, black head is instead caused by a mutation to the BMP4 gene causing an increase in BMP4 protein. As it happens, this increase is almost exactly the rate at which it is reduced in spider, and so by breeding them together, the end result is a near normal level of BMP4 which causes a near normal ball python to develop. This happens differently when bred to other head wobble morphs, but this is because the other head wobble morphs are caused by different levels of BMP4 protein available during development. It's visually clear that not all of the head wobble morphs share the same level of head wobble, and the amount of head wobble is probably in ratio with the amount of BMP4 lost, where spider is likely the greatest decrease in BMP4 since head wobble appears to be the worst in the spider gene. It just happens by luck that spider and black head share an extremely similar positive/negative relationship and cancel each other out as so.
    Super phantom has the interesting attribute of not being allelic with spider but seems to cancel out the spider characteristics. This is likely due to phantom being caused by a mutation on one of BMP4's antagonists like noggin [5] and not BMP4 itself. By reducing the amount of noggin (or other antagonist) available during development, it makes it so that the reduced BMP4 is actually substantial enough to develop the snake normally, however the reduced antagonist would still cause the change in phenotype to that of super phantom. Essentially it is removing BMP4's opponent to allow less BMP4 to handle the work of a normal amount of BMP4. This type of epistatic relationship is what makes Pearl ball pythons a possibility in multi-morph ball pythons. By adding genes that effect the antagonists, there will come a time when the antagonists are so reduced that the snake can develop with minimal/no issues however we would also expect a change in phenotype and it not to completely resemble a normal pearl.


    I think I covered just about everything I found. Let me know what everyone thinks, and if this seems reasonable. I based all of this on my understanding of the spider gene and it's allelic sisters, but if there's something that doesn't make sense please let me know since it might represent a hole in my own understanding. It'll be a difficult idea to ever prove or gather sufficient evidence for without investing in the entire genomics process, but it's still fun to think about and collect information providing support. Hopefully I explained everything well enough, but I'd be happy to clarify anything through edits later on.




  2. The Following 10 Users Say Thank You to Natural For This Useful Post:

    Alicia (02-20-2019),Bogertophis (02-19-2019),cletus (02-22-2019),e_nigma (02-23-2019),FollowTheSun (02-19-2019),Godzilla78 (02-20-2019),MarkL1561 (02-19-2019),paulh (02-21-2019),Ronniex2 (03-08-2019),Timelugia (02-23-2019)

  3. #2
    BPnet Veteran FollowTheSun's Avatar
    Join Date
    11-15-2018
    Posts
    674
    Thanks
    1,351
    Thanked 1,102 Times in 461 Posts

    Re: Spider Morph Head Wobble Hypothesis

    I haven't watched the video yet but I will in a while. I very much enjoyed your post, it's fascinating, and it makes a lot of sense. Bravo to your research you may just beyond a something!

    Sent from my SM-G960U1 using Tapatalk
    2 BP's, one ratsnake, 2 dogs, 3 cats, 2 small caged birds, 7 chickens, and a toddler in a pear tree

  4. #3
    BPnet Senior Member Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    1,939
    Thanks
    889
    Thanked 4,166 Times in 1,545 Posts
    Images: 120

    Re: Spider Morph Head Wobble Hypothesis

    Quote Originally Posted by Natural View Post
    It'll be a difficult idea to ever prove or gather sufficient evidence for without investing in the entire genomics process
    You said it.

    We can send 23andMe some ball python saliva and tell them to map it for us.
    *.* TNTC

  5. The Following User Says Thank You to Lord Sorril For This Useful Post:

    Bogertophis (02-20-2019)

  6. #4
    Registered User
    Join Date
    02-16-2017
    Location
    Florida
    Posts
    20
    Thanks
    9
    Thanked 27 Times in 12 Posts

    Re: Spider Morph Head Wobble Hypothesis

    Quote Originally Posted by FollowTheSun View Post
    I haven't watched the video yet but I will in a while. I very much enjoyed your post, it's fascinating, and it makes a lot of sense. Bravo to your research you may just beyond a something!

    Sent from my SM-G960U1 using Tapatalk
    Thanks!!


    Quote Originally Posted by Lord Sorril View Post
    We can send 23andMe some ball python saliva and tell them to map it for us.
    Gosh I wish. I have so many questions I want answered. I can't even imagine how they'd react if you sent in ball python samples and they spent all of their time sequencing it trying to find human predisposed diseases and ancestry.

  7. #5
    BPnet Senior Member Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    1,939
    Thanks
    889
    Thanked 4,166 Times in 1,545 Posts
    Images: 120

    Re: Spider Morph Head Wobble Hypothesis

    Quote Originally Posted by Natural View Post
    I can't even imagine how they'd react if you sent in ball python samples and they spent all of their time sequencing it trying to find human predisposed diseases and ancestry.
    Hahaha yeah, I've already considered it, but, since ball pythons have 18 pairs of chromosomes instead of our 23---they would figure out something was wrong real fast
    Last edited by Lord Sorril; 02-20-2019 at 07:46 PM.
    *.* TNTC

  8. The Following User Says Thank You to Lord Sorril For This Useful Post:

    Bogertophis (02-20-2019)

  9. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Spider Morph Head Wobble Hypothesis

    Quote Originally Posted by Natural View Post
    It'll be a difficult idea to ever prove or gather sufficient evidence for without investing in the entire genomics process
    There is no need to interrogate the entire genomics process, you could prove it with a quick PCR reaction.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. The Following User Says Thank You to asplundii For This Useful Post:

    Bogertophis (02-21-2019)

  11. #7
    Registered User Treeman's Avatar
    Join Date
    01-26-2019
    Posts
    153
    Thanks
    16
    Thanked 125 Times in 78 Posts

    Re: Spider Morph Head Wobble Hypothesis

    Quote Originally Posted by asplundii View Post
    There is no need to interrogate the entire genomics process, you could prove it with a quick PCR reaction.
    Right uh... yea. Just a simple PCR reaction. What i was gonna say...

    Im smart in other ways


    Sent from my iPhone using Tapatalk

  12. #8
    Registered User
    Join Date
    02-16-2017
    Location
    Florida
    Posts
    20
    Thanks
    9
    Thanked 27 Times in 12 Posts

    Re: Spider Morph Head Wobble Hypothesis

    Quote Originally Posted by asplundii View Post
    There is no need to interrogate the entire genomics process, you could prove it with a quick PCR reaction.
    Even if we did PCR, we’d still have to get it sequenced since PCR would just create the necessary amount of DNA for sequencing but wouldn’t actually give us any information. Sequencing is what actually costs a lot, and without sequencing we’d have no idea where the mutation lies. Even then we’d need to sequence several normal and spider ball pythons in order to make better supported comparisons and be able to eliminate genetic background noise between the individuals.

  13. #9
    BPnet Veteran alittleFREE's Avatar
    Join Date
    05-05-2010
    Location
    Georgia
    Posts
    807
    Thanks
    236
    Thanked 521 Times in 286 Posts

    Re: Spider Morph Head Wobble Hypothesis

    Check out Rare Genetics Inc. They are doing a lot of work with snake DNA sequencing.




    Sent from my iPhone using Tapatalk

    - Summer

    0.1 Bearded Dragon ("Reka")
    0.1 California Kingsnake ("Cleo")
    0.1 Cinnamon Spider Het. Albino Ball Python ("Syd")
    1.0 Hypo Bredl’s Python (“Oz”)

  14. The Following User Says Thank You to alittleFREE For This Useful Post:

    Natural (02-22-2019)

  15. #10
    BPnet Veteran the_rotten1's Avatar
    Join Date
    07-22-2016
    Location
    Bakersfield, CA
    Posts
    613
    Thanks
    3,352
    Thanked 645 Times in 319 Posts
    Images: 11
    Interesting. I've always heard the wobble described as a neurological issue, but if it is has more to do with the inner ear, that may not be true. Though, I suppose that in pearls/super spiders it could still be considered neurological because of the deformed spine.

    From what I've seen of the wobble so far, I would definitely agree that it causes difficulty balancing. It doesn't seem to affect them much when their heads are touching the ground. As long as they can feel something underneath them they can orient themselves. But when they're up in the air they would have to rely on their ears, since there's nothing to touch. So it makes a lot of sense to me that the wobble would have something to do with the inner ear.
    ~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~

    Check me out on iHerp, Instagram, & visit my store!


Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1